PROTOCOL:

*For figures and references, please check the paper (http://www.jove.com/video/52610) or the video

This protocol is also available as a Word document.

**
**

1) Construction of chimeric HIV-1 NL4-3 molecular clones

1.1) Amplify insert DNA fragment

1.1.1) Design chimeric primers. The 5' halves of both forward and reverse primers contain an HIV-1 vector sequence, at which the fragment will be inserted. The 3' half of the primers must contain the end of the insert sequence (Figure 2). Make sure that the chimeric primer sequence retains the original open reading frames.

1.1.1.1) Use primers at least 20 bases in length, with a melting temperature greater than or equal to 60 °C, ~50% GC content, and a low tendency to form primer dimers, heterodimers and/or hairpin structures. These properties can be assessed using the OligoAnalyzer web tool (https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/)

1.1.2) Use PCR²⁷ and the chimeric primers to amplify insert DNA (Figure 2). For each PCR reaction, use 1X high fidelity buffer, 0.2 mM dNTPs, 1 U high fidelity DNA polymerase, 0.5 µM of forward chimeric primer, 0.5 µM of reverse chimeric primer, and 1 pg - 10 ng of DNA sample carrying insert region. Add dH₂O to a final volume of 50 µl.

1.1.3) Set thermal cycling steps as follows: Perform an initial DNA denaturation step at 98 °C for 10 sec. Amplify with 30 cycles of DNA denaturation at 98 °C for 10 sec and DNA annealing at 3 °C above the lowest melting temperature of the two primers for 20 sec. Perform a final extension at 72 °C for 10 min. Store PCR products at 4 °C.

1.1.4) Take 5 µl of the PCR products from the previous step and run agarose gel electrophoresis²⁸.

1.1.4.1) Use a 0.7% agarose gel, 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA), 0.5 μg/ml ethidium bromide (EtBr) final concentration and 1 kb ladder as the DNA size marker. Set power source voltage to 5 V/cm distance between electrodes. Stop the electrophoresis when the loading dye migrates through about 2/3 of the gel length. Visualize the gel using a gel documentation system²⁸.

Note: EtBr is a suspected carcinogen and must be properly disposed of, per institution regulations. Gloves should always be worn when handling gels containing EtBr. Change to new gloves after finish handling EtBr containing material and before handling other materials or equipment to prevent cross contamination.

1.1.5) If only one DNA band with size corresponding to the desired PCR product is detected, purify the rest of the PCR product using a commercial kit such as QIAquick PCR Purification Kit according to the manufacturer’s protocols.

1.1.5.1) If other, non-specific bands are also present, use the rest of the PCR product to run preparative gel electrophoresis. Use the same parameters and conditions specified in step 1.1.4. Ensure that the gel well is large enough to load ~45 µl of PCR products. Cut out the band of interest and extract the DNA from the gel using QIAquick gel extraction kit according to the manufacturer’s protocols.

1.2) Introduce the insert fragment into full-length infectious HIV-1 subtype B vector (pNL4-3)

1.2.1) Use purified PCR products from step 1.1.5 as PCR primers. Use pNL4-3VifA²⁰ as template DNA in one PCR reaction and use pNL4-3VifB²⁰ as template in the other reaction (Figure 2). For each PCR reaction, use 1X high fidelity buffer, 0.2 mM dNTPs, 2 U high fidelity DNA polymerase, 500 ng of primer DNA and 50 ng of template DNA in a final volume of 50 µl. Set the thermal cycling parameters to: 98 °C for 30 sec, 35 cycles at 98 °C for 10 sec, 48 °C for 1 min and 72 °C for 10 min, followed by 72 °C for 10 min.

1.2.2) Add 10 U of DpnI to 50 µl of the PCR reaction and incubate at 37 ^oC for 1 hr to digest the template DNA. Ensure that the plasmid DNA is isolated from a methylation competent bacterial strain, e.g., TOP10 chemically competent Escherichia coli.*

*

1.2.3) Use DpnI digested product to transform competent bacterial cells. Use heat-shock transformation with TOP10 chemically competent E. coli, according to the manufacturer’s protocol. To select for bacterial cells containing the recombinant plasmid, use Luria Broth (LB) culture plates containing 100 mg/L carbenicillin.

1.2.3.1) Pick ~10 well-separated colonies and grow each separately in 3 ml LB liquid medium containing 100 mg/L carbenicillin and incubate at 30 °C in a shaker overnight.*

*

1.2.3.2) Use QIAprep Spin Miniprep kit to isolate plasmid DNA from the bacterial liquid culture, according to the manufacturer’s protocol.

1.2.4) Use double restriction digestion²⁹ to determine whether the plasmid DNA contains the proper ** insert. Ensure that one of the restriction sites exists only within the insert region and the other restriction site exists only once in the HIV-1 vector, outside of the insert region.

1.2.4.1) Digest at least 300 ng of plasmid DNA in a 10 µl final reaction volume. Select restriction buffers, incubation temperature and incubation time according to the manufacturer’s protocol of the selected restriction enzymes. Take 9 µl of the digested DNA and run gel electrophoresis as described in step 1.1.4. Select recombinant plasmids that have DNA bands of the predicted sizes.

1.2.5) Confirm sequence integrity of the recombinant plasmids by Sanger sequencing. While rare, unwanted mutation(s) can be introduced during the PCR reactions.

1.2.5.1) Sequence both strands of the plasmid DNA. Follow instructions in step 1.1.1.1 to design sequencing primers. In addition, ensure that the forward and reverse sequencing primers anneal at least 50 bp upstream and downstream of the insert region in the recombinant plasmid, respectively.

1.2.5.2) Submit plasmid DNA and sequencing primers to a commercial DNA sequencing service provider. Prepare DNA sample and primers as specified by the service provider.

1.2.6) Make an endotoxin-free stock of the mutated plasmid DNA using an Endotoxin free plasmid DNA kit according to manufacturer’s protocol. Prepare at least 1 µg of endotoxin-free plasmid DNA for transfection in the following step.

1.3) Introduce small-scale mutations via site-directed mutagenesis

1.3.1) Design mutagenic primers with overlapping forward and reverse primers containing the desired mutation(s). Position the base(s) to be substituted, inserted, or deleted in the middle of the primers, flanked by 10-15 homologous bases. Follow instructions in step 1.1.1.1.

1.3.2) Use PCR to synthesize mutant plasmids. For each PCR reaction, use 1X high fidelity buffer, 10 mM dNTPs, 2 U of high fidelity DNA polymerase, 0.5 µM of forward mutagenic primer, 0.5 µM of reverse mutagenic primer and 50 ng of chimeric pNL4-3VifB, from step 1.2.6, in a final volume of 50 µl. Set the thermal cycling parameters to: 98 °C for 30 sec, 25 cycles at 98 °C for 10 sec, 48 °C for 1 min and 72 °C for 10 min, followed by 72 °C for 10 min.

1.3.3) Repeat step 1.2.2 to 1.2.6.

2) Generation of viral stock using transfection

2.1) Calculate the amount of viral stock desired and plasmid DNA required. With a viral titer of 10⁴ IU/ml or higher, 1.8 ml of viral stock is sufficient for two sets of growth competition assays, including monoinfections, each done in triplicate. For a transfection done in a 6-well plate, about 1.8 ml supernatant is harvested per well. One µg of plasmid DNA is needed for each transfection done in a 6-well plate.

2.2) For each well of a 6-well plate, prepare 100 µl of transfection mixture, e.g., consisting of 1 µl X-tremeGENE 9 transfection reagent (or comparable product), 1 µg of plasmid DNA and serum-free DMEM.

2.2.1) Determine the volume of plasmid DNA needed, using 1 µg plasmid DNA per well. Ensure that the final concentration of the plasmid DNA is at least 50 ng/µl.

2.2.2) Determine how much serum-free medium (DMEM) is needed per well using the formula: Total volume of DMEM in µl = 100 µL - DNA volume in µl.

2.3) Add 10⁶ HEK 293T-17 (ATCC) cells/well in 2 ml of propagation medium (DMEM + 10% fetal bovine serum (FBS)) into a 6-well plate. Incubate for 1 hr at 37 ^oC in a 5% CO₂ atmosphere. Seed as many wells as needed (determined in step 2.1).

2.4) To prepare the transfection mixture, aliquot the appropriate volume of serum-free DMEM, as calculated above, into a 1.8 ml polypropylene microcentrifuge tube, and then add the transfection reagent.

2.4.1) Pipette reagent directly into the media solution, do not add it to the plastic surface of the microcentrifuge tube. Add plasmid DNA last. Pipet up and down gently to mix the solution. Incubate for 15 min at room temperature (15 ^oC to 25 ^oC) to allow the formation of transfection complexes.

2.4.2) Add the mixture in a drop-wise manner to cells seeded in the 6-well plate. Gently shake or swirl the wells to ensure even distribution of transfection complexes.

2.4.3) Seal plates with plastic wrap.

2.5) Incubate cultures at 37 ^oC in a 5% CO₂ atmosphere for 48 hr.

2.6) Use a pipette to carefully collect and transfer supernatant to a 15 ml tube through a 0.22 µm filter top.

2.7) Use pipette to transfer 250 µl or more of the filtered supernatant to 1.8 ml microfuge tubes with rubber gaskets in the lids.

2.8) Store filtered supernatants at -80 ^oC until use.**

3) Determine infectious titer of viral stocks on peripheral blood mononuclear cells (PBMCs)

3.1) Stimulate PBMCs with phytohemagglutinin (PHA). Per one viral stock, seed 2 x 10⁶ PBMCs in complete Iscove’s Modified Dulbecco’s Medium (cIMDM; IMDM supplemented with 20 U/ml of human interleukin 2 (hIL-2), 10% fetal bovine serum and 1% penicillin/streptomycin) supplemented with PHA (1.5 µg/ml). Seed PBMCs at 2 x 10⁶ cells/ml. Incubate PBMCs at 37 ^oC in a 5% CO₂ **** atmosphere **** for 72 hr.

3.2) Harvest PHA stimulated PBMCs. Transfer non-adherent PHA-PBMCs to a 50 ml conical tube. Spin tube at 228 x g for 10 min. Carefully remove supernatant without disrupting the cell pellet. Re-suspend the cell pellet to a final concentration of 2 x 10⁵ PBMCs/ml in cIMDM.

3.3) Seed 2x10⁴ PHA stimulated PBMCs/well in 100 µl/well cIMDM in a round bottom 96-well plate.

3.4) Make a 1:10 dilution of the viral stock. Then, from the first diluted stock, make twelve 3-fold serial dilutions in a 96-well master plate. This dilution scheme is recommended for detecting viral titers in the range of 10⁴ to 10⁶ infectious unit (IU) per ml. For example, add 20 µl of virus stock to 180 µl media in the 1.5 ml tube. Mix the dilution by pipetting carefully. Then transfer 90 µl of the diluted stock into 180 µl media of the first well and mix well by pipetting. Continue dilution series by transferring 90 µl from the current well to 180 µl media in the next well eleven more times. Increase or decrease the initial dilution if titers higher than 10⁶ IU/ml or lower than 10⁴ IU/ml are expected, respectively.

3.5) Add 40 µl of the serially diluted viral stock from the master dilution plate to the seeded PBMCs plate (from step 3.3) in quadruplicate. Incubate plates at 37 ^oC in a 5% CO₂ **** atmosphere **** for 16-24 hr.

3.6) Carefully remove 100 µl supernatant from each well, and replace with 160 µl fresh cIMDM to a total volume of 200 µl/well. Incubate plates at 37 ^oC with 5% CO₂ **** atmosphere (day 1).

3.7) On days 4, 7, 10 and 13 transfer 100 µl supernatant from each well to 100 µl disruption buffer (2 % TritonX-100 in PBS), and replace with 100 µl fresh cIMDM. Store the supernatants at -20 ^oC.

3.7.1) Keep sampling and adding fresh cIMDM every three days until the titer stabilizes.

3.8) Determine the 50% tissue culture infectious dose (TCID₅₀) of the viral stock by p24 ELISA using the day 7 and 13 samples as described in step 4.

3.8.1) If the TCID₅₀ obtained from day 13 is clearly higher than the titer from day 7, the virus stock may need a longer time to expand. Repeat the p24 ELISA using later samples until the infectious titers from two sampling time points become stable (or decrease). Stocks should be selected from samples with the highest titers.

4) **ELISA (Enzyme-linked Immunoabsorbant assay) detection of HIV-1 p24 for determining viral infectious titer

**Note: The following protocol was developed using p24 antigen capture plates prepared in our laboratory³⁰. Commercial HIV-1 p24 ELISA plate/kits can also be used, following the manufacturer’s protocol.

4.1) Prior to working with samples, prepare working stocks of primary antibody (rabbit anti-HIV-1 SF2 p24 antiserum).

4.1.1) Thaw p24 antiserum at room temperature (RT).

4.1.2) Mix 2.5 ml glycerol with 2 ml 10% FBS in phosphate buffer saline (PBS).

4.1.3) Add 0.5 ml antiserum and mix.

4.1.4) Store 1 ml aliquots at -20 ^oC.

4.2) Thaw samples from step 3.7 in 37 ^oC incubator.

4.3) Wash the p24 capture plate 5 times with wash buffer (1x PBS with 0.05% Tween-20).

4.4) Add 50 µl/well of sample diluent (1% bovine serum albumin (BSA), 0.2% Tween-20 in RPMI-1640), then add 50 µl of sample to appropriate wells. Include at least three wells with sample diluent only as mock / negative controls. Incubate for 2 hr at 37 ^oC or overnight at 4 ^oC.

4.5) Prepare the primary antibody solution fresh before use. Make a 1:2,000 fold dilution of the primary antibody working stocks using the primary antibody diluent (12% FBS in RPMI-1640). Ensure to prepare enough for the use of 100 µl solution per each sample/control well in a 96-well plate.

4.5.1) For example, to make enough solution for one 96-well plate, add 5 µl of the primary antibody working stocks to the primary antibody diluent for a final volume of 10 ml.

4.6) Wash capture plate 5 times with wash buffer.

4.7) Add 100 µl of the primary antibody solution to each well. Incubate for 1 h at 37 ^oC in a 5% CO₂ atmosphere.

4.8) Prepare the secondary antibody solution fresh before use. Make a 1:14,400 fold dilution of the secondary antibody (1 mg/ml Goat anti-rabbit HRP) using the secondary antibody diluent (7 % FBS, 0.01 % Tween-20 in RPMI-1640). To reduce pipetting errors, perform a two-step serial dilution. Ensure to prepare enough for the use of 100 µl solution per each sample/control well in a 96-well plate.

4.8.1) For example, to make enough solution for one 96-well plate, first add 1 µl of the secondary antibody to 99 µl of the secondary antibody diluent. Then add 70 µl of first dilution to the secondary antibody diluent for a final volume of 10 ml.

4.9) Wash capture plate 5 times with wash buffer.

4.10) Add 100 µl of the secondary antibody solution to each well. Incubate for 1 hr at 37 ^oC in a 5% CO₂ atmosphere.

4.11) Wash plate 5 times with wash buffer.

4.12) Add 100 µl of room temperature TMB substrate. Incubate 30 min at room temperature in a closed container to protect from light.

4.13) Add 100 µl of room temperature stop solution (1 N H₂SO₄).

4.14) Read absorbance at 450-650 nm in each well using a microplate reader. Use the absorbance value to score each well as infected or uninfected. A well is considered to contain infectious virus if the absorbance value is at least three times higher than the value read from mock / negative control wells. Calculate TCID₅₀ of the viral stock using the Reed-Meunch method³¹.

5) **Establish viral growth kinetics

**

5.1) Monoinfection

5.1.1) Seed 3x10⁵ PHA-stimulated PBMC/well in 48-well plates in a total volume of 500 µl/well. Keep the culture plates at 37 ^oC in a 5% CO₂ atmosphere until inoculation.

5.1.2) For each virus, prepare an inoculum containing 6,000 IU in 2 ml of cIMDM.

5.1.3) Inoculate wells in triplicate by adding 500 µl of the inoculum (1,500 IU) to the seeded cells. The final volume of the infected cell culture is 1 ml/well and the MOI is 0.005.

5.1.4) Aliquot 200 µl of the remaining inoculum to each of two 96-well plates for RNA isolation, one of which is saved as a backup.

5.1.5) Incubate cultures at 37 ^oC in a 5% CO₂ atmosphere for 16-24 h.

5.1.6) Wash cultures 16-24 h after inoculation.

5.1.6.1) Remove and discard 750 µl of culture supernatant.

5.1.6.2) Add 750 µl of fresh cIMDM. Wrap plates in plastic wrap and spin for 10 minutes at 300 x g. Remove and discard 750 µl supernatant.

5.1.6.3) Add 750 µl of fresh cIMDM. Incubate at 37 ^oC with a 5% CO₂ atmosphere (day 1)**.

**

5.1.7) Sample cultures daily from day 2 to day 7.

5.1.7.1) Transfer 500 µl of culture supernatant to a 1.8 ml centrifuge tube. Spin for 1 min at 3000 x g.

5.1.7.2) Transfer 200 µl of the cell-free supernatant to the two 96-well sample plates for RNA isolation, again saving one plate as backup. Store supernatants at -80 ^oC until RNA isolation.

5.1.7.3) Add 500 µl fresh cIMDM to each culture. Incubate at 37 ^oC in a 5% CO₂ atmosphere.

5.1.7.4) Discard cultures into Wescodyne at the end of the experiment.

5.1.7.5) Isolate RNA from 200 µl of supernatant (use commercial kits such as QIAamp Viral RNA Mini Kit) following the manufacturer’s standard protocol. For a large number of samples, use the Qiagen QIAxtractor.

5.1.7.6) Store RNA samples at -80 ^oC until cDNA synthesis.

5.2) cDNA synthesis (Reverse transcription)

5.2.1) For each RNA sample, add 1.2 nmol of dNTP and 1.2 pmol of cDNA synthesis primer, (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3', HXB2 nucleotide 7968 to 7995) to 10 µl of viral RNA. Add water to a final volume of 14 µl. Flick the tube to mix and spin briefly to collect liquid at the bottom of the tube.

5.2.2) Incubate mixture for 5 min at 65 ^oC, then hold at 4 ^oC until the master mix is prepared.

5.2.3) Prepare master mix using 5x first-strand buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl₂), 5 mM DTT, 120 U of SuperScriptIII and 240 U of Rnase inhibitor. Add water to final volume of 10 µl.

5.2.4) Add 10 µl of master mix to RNA mixture, flick to mix and spin to collect.

5.2.5) Incubate mixture for 90 min at 50 ^oC to allow synthesis of cDNA. Incubate for 15 minutes at 70 ^oC to inactivate reverse transcriptase. Hold at 4 ^oC as needed.

5.2.6) Add 2 U of Rnase H, flick to mix, and then spin to collect.

5.2.7) Incubate 20 min at 37 ^oC. Store cDNA at -20 ^oC.

5.3) **cDNA quantitation using qPCR system

**

5.3.1) Prepare a standard dilution series. Do 10-fold serial dilution, from 3 x 10⁶ copies/µl down to 30 copies/µl, of pNL4-3VifA. Use distilled water for dilutions. Prepare the standard dilution series fresh before use or prepare small batches and keep at -20 ^oC. Do not freeze-thaw the standards more than three times.

5.3.2) Set up a 96-well qPCR reaction plate. Ensure that each plate contains at least one well of negative controls, a triplicate of the standard dilution series, and at least a duplicate of each cDNA sample.

5.3.3) For each qPCR reaction, use 12.5 µl of qPCR master mix, 0.2 µM probe, 0.8 µM each of the forward and reverse primers and 1 µl of cDNA or the standard dilution series or water/buffer (for the negative control well). Add water to a final volume of 25 µl. The qPCR probe is light sensitive. Keep it in closed container.

5.3.3.1) To detect cDNA derived from pNL4-3VifA based molecular clone, use the VifA primer-probe: VifAB forward primer (GGTCTGCATACAGGAGAAAGAGACT), VifA reverse primer (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3') and VifAB probe (6FAM-5'-CTCCATTCTATGGAGACTC-3'-MGBNFQ). For cDNA derived from pNL4-3VifB based clone, use the VifB primer-probe: VifAB forward primer, VifAB probe and VifB reverse primer (5'-CACCTGCGTGCTATACCTTTTCT-3').

5.3.4) Set PCR cycling parameters to 50 ^oC for 2 min, 95 ^oC for 10 min, and 40 cycles of 95 ^oC for 15 sec and 60 ^oC for 1 min. Consult the manufacturer’s support document for operation of the qPCR machine.

5.3.5) Calculate a standard curve using data from the triplicate standard dilution series. Compare amplification data of the cDNA sample to the standard curve to determine the copy number. Consult the manufacturer’s support document for data processing.

5.4) **Determine viral exponential growth phase

**

5.4.1) Plot viral growth kinetics with the sampling day along the X-axis and the cDNA copy number along the Y-axis and identify the viral exponential growth phase, i.e., when viral cDNA copy numbers increase in an exponential progression.

5.4.2) Use the GRC web tool (http://indra.mullins.microbiol.washington.edu/grc/) to calculate viral growth rate (g). In this application, the GRC tool accepts cDNA copy numbers from at least two time points as input, and outputs the viral growth rate (g). Use only time point data within the exponential growth phase (see step 5.4.1 above) to obtain accurate growth rates. For a detailed description of the mathematical model used in the GRC web tool, see²⁰.

6) **Growth Competition Assay

**

6.1) Seed 3 x 10⁵ PHA-stimulated PBMCs (or 1 x 10⁵ CEMx174 cells) in 500 µl total volume per well in a 48 well flat-bottomed plate.*

*

6.2) Keep plate in 37 ^oC in a 5% CO₂ atmosphere until inoculation.

6.3) For each virus, prepare 3 ml of inoculum containing 6,000 IU.

6.4) Transfer 1.5 ml of each viral inoculum to a sterile tube to create the dual infection inoculum. Add 500 µl of the dual inoculum (1,500 IU) to 3 x 10⁵ cells in a 48-well plate. The final culture volume is 1 ml/well. Aliquot 200 µl of the inoculum to two 96-well plates for RNA isolation; save one plate as a back up.

6.5) Incubate inoculated cells at 37 ^oC with a 5% CO₂ atmosphere for 16-24 hr.

6.6) Wash cultures 16-24 h after inoculation.

6.6.1) Remove and discard 750 µl of culture supernatant.

6.6.2) Add 750 µl of fresh cIMDM. Wrap plates in plastic wrap and spin for 10 minutes at 300 x g. Remove and discard 750 µl supernatant.

6.6.3) Add 750 µl of fresh cIMDM. Incubate at 37 ^oC with a 5% CO₂ atmosphere (day 1).

6.7) Select sampling times to include at least 3 time points within the exponential growth phase observed in step 5.4.1.

6.7.1) For each sampling, follow step 5.1.7.

6.8) Perform cDNA synthesis as described in section 5.2.

6.9) Determine the viral variant ratio using qPCR.

6.9.1) Prepare a standard serial dilution series in triplicate, diluting 10-fold in each step from 3 x 10⁶ copies/µl to 30 copies/µl of pNL4-3VifA.

6.9.2) Set up a 96-well qPCR reaction plate. Ensure that each plate contains at least one negative control, the standard dilution series in triplicate, and duplicates of each cDNA sample.

6.9.3) For each qPCR reaction, use 12.5 µl of qPCR Master Mix, 0.2 µM probe, 0.8 µM each of the forward and reverse primers and 1 µl of cDNA or the standard dilution series or water/buffer (for the negative control wells). Add water to a final volume of 25 µl. The qPCR probe is light sensitive, keep it in closed container.

6.9.3.1) Use the VifA primer-probe to detect signals in the negative controls and the standard dilution series and with one duplicate of the cDNA sample. Use the VifB primer-probe with the other duplicate of the cDNA sample.

6.9.4) Set PCR cycling parameters to 50 ^oC for 2 min, then 95 ^oC for 10 min, and then 40 cycles of 95 ^oC for 15 sec and 60 ^oC for 1 min. Consult the manufacturer’s support document for operation of the qPCR machine.

6.9.5) Calculate the standard curve using amplification data from the standard dilution series. Compare amplification data of the cDNA samples to the standard curve to determine copy number. Consult the manufacturer’s support document for data processing.

6.9.6) Use the GRC web tool (http://indra.mullins.microbiol.washington.edu/grc/) to calculate relative viral fitness (d). The GRC tool accepts cDNA copy numbers or chromatogram peak heights from at least two time points as the input, and outputs the net growth rate difference (d) between the two viruses. While the tool can calculate the net growth rate from two time point data, it is strongly recommended to input data from three or more time points. Use only data obtained from time points within the exponential growth phase (see step 5.4) to obtain accurate growth rates. For a detailed description of the mathematical model used in the GRC web tool, see²⁰.

6.10) Determine viral ratios using chromatogram peak-heights

6.10.1) PCR amplify HIV-1 vif fragments containing the VifAB sequence tag using VifFwd (5′-GAAAGAGACTGGCATTTGGGTCAGGG-3′; HXB2 positions 5266-5291) and VifRev primers (5′-GTCTTCTGGGGCTTGTTCCATCTGTCC-3′; HXB2 positions 5579-5553).

6.10.1.1) For each PCR reaction, use 1 µl of cDNA, 1X NH₄ buffer, 1.5 mM MgCl₂, 0.2 mM dNTP, 2.5 U of Taq Polymerase, and 0.45 µM of each primer. Add water to a final volume of 50 µl.

6.10.1.2) Set PCR cycling parameters to 3 cycles at 94 ^oC for 1 min, 55 ^oC for 1 min, and 70 ^oC for 1 min, followed by 34 cycles at 94 ^oC for 15 sec, 58 ^oC for 30 sec, and 70 ^oC for 1 min, and then hold at 4 ^oC.

6.10.2) Purify PCR products using the QIAquick PCR purification kit according to the manufacturer’s protocol.

6.10.3) Submit purified PCR products to a DNA sequencing service provider for Sanger sequencing.

6.10.4) Check the average read quality score, which should be provided by the sequencing service. If the average base call accuracy is less than 85%, redo step 6.10.1 to 6.10.3

6.10.5) Use the ChromatQuant web tool (http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi) to calculate viral ratio at each time point. The tool requires the sequence trace file (*.ab1) and the sequence 5' to the nucleotide site of interest. The tool measures the peak intensity at the specified site. The ratio of the peak intensity corresponds to the ration of the two viruses (Figure 4B).

6.10.6) Use the GRC web tool (http://indra.mullins.microbiol.washington.edu/grc/) and the recorded peak intensities as the input to calculate viral relative fitness (d). See step 6.10.6.²⁰

Reagents:

• ¹⁴C Acetic acid sodium salt, Amersham CFA.13, 0.2 µCi/µl

• 1x PBS

• H₂O

• Chloroform, Methanol, Hexane, Isopropanol, 4 L, Stores

• Long glass tubes and glass pipettes

• Micropipette, VWR 53432-783

• TLC Silica gel 60 (20 x 20 cm), VWR EM-11845-7, 25/$231.53

• Carrier lipid stocks; UC (unstearified cholesterol) 1 mg/ml, CE (cholesterol ester) 0.5 mg/ml, TG (triglyceride) 1 mg/ml.

• Neutrolipid solvent (N.L.); 108 ml hexethane, 1.2 ml HAc (glacial), 30 ml Diethyl Ether (anhydrous); available at Stores

• Iodine Crystals

• Scintillation Fluid (Ecolume) and vials (Wheaton #986644)

Protocol:

1. Set up cultures at 5 x 10⁵ cells/ml in 2 ml with ¹⁴C acetate (10 µl at 0.2 µCi/µl – final 1 µCi/µl).

2. Grow 1 to 2 hours.

3. Wash with 1x PBS (important to remove FBS).

4. Store cell pellet at -20°C until ready for further processing.

5. Add 1 ml Hexane:Isopropanol 3:1 v/v (to extract lipids from pellet).

6. Vortex.

7. Incubate 30 minutes at RT.

8. Transfer supernatant to new glass tube careful not to touch the pellet.

9. Wash pellet with 1 ml Hexane:Isopropanol. Transfer supernatant to same glass tube.

10. Evaporate to dryness under air stream in 40°C heat block.

11. Add 4 ml Folch (chloroform:methanol 2:1 v/v).

12. Add 1 ml H₂O.

13. Add 20 µg complete carrier lipid to each sample.

14. Vortex.

15. Incubate 20-30 minutes at RT.

16. Vortex.

17. Spin for 10 minutes at 2000 rpm.

18. Aspirate top aqueous phase, keep organic phase.

19. Add 1 ml H₂O.

20. Vortex.

21. Spin for 10 minutes at 2000 rpm.

22. Aspirate top aqueous phase, keep organic phase.

23. Evaporate to dryness under air stream in 40°C heat block.

24. Rinse sides with chloroform.

25. Evaporate to dryness under air stream in 40°C heat block.

26. Resuspend in 110 µl chloroform.

27. Spot at ~1.5 cm from bottom of gel (above tank solvent).

    1. Spot carrier alone for a reference band.

1. Place gel in tank with solvent and run.

   1. Run until gel is completely saturated ~20 min.

   2. Dry gel on 40°C heat block.

1. Place gel in tank of fresh iodine crystals until all bands are clearly visible.

2. Mark bands of interest with pencil.

3. Dry gel until iodine stained bands are clearly not visible.

4. Cut marked bands into scintillation vials and add 4.5 ml scintillation fluid.

Reference: Oram Lab, Medicine, Metabolism Endocrinology, University of Washington

Reagents:

• ¹⁴C mevalonic acid DBED salt, NEC166, 0.1 µCi/µl

• 1x PBS

• H₂O

• Glass tubes, 16 ml, VWR 60828-387, 72/$134.02

• Glass tubes, 50 ml, VWR 60828-423, 36/$112.25

• Chloroform, 4 L, Stores

• Methanol, 4 L, Stores

• N₂ gas stream

• Petroleum ether (35-60°C), 1 L, Stores 0014-285, $8.99

• Na₂SO₄ (anhydrous), 3 kg, Stores 0004-410, $28.09

• Glass pasteur pipette

• Glass wool

• Toluene (purified), 4 L, Stores 0015-070, $17.45

• Ethyl ether (anhydrous), 1 L, Stores 0012-625, $17.14

• TLC silica gel 60 (20 x 20 cm), VWR EM-11845-7, 25/$231.53

• Iodine (crystal), VWR MK098402, 125 g/$98.40

Protocol:

1. Set up culture at 10⁶ cells/ml in 100ml with ¹⁴C mevalonate
   (50 µl at 0.1 µCi/µl – final 0.05 µCi/ml).

2. Grow 0 to 48 hours.

3. Wash with 1x PBS (important to remove FBS).

4. Resuspend in 1ml H₂O. Use glass tubes from here on.

5. Add to 10ml chloroform:methanol (2:1 v/v).

6. Stir at RT for 3 hours.

7. Evaporate under N₂ gas stream for ~1 hour until solution turns cloudy.

8. Extract 2x with 10 ml petroleum ether at 40-60°C.

9. Lower fraction ~500 µl, transfer upper fraction (x2) to 50 ml tube.

10. Dry with anhydrous Na₂SO₄.

11. Filter through pasteur pipette with glass wool.

12. Evaporate to dryness under N₂.

13. Store at -20°C until use.

14. Place 100 ml solvent in tank (toluene:diethylether 9:1 v/v).

15. Resuspend samples in 100 µl petroleum ether (vaporizes rapidly).

16. Spot at ~1.5 cm above bottom of gel.

17. Place gel in tank and run about 1.5 hrs or until solvent front reaches about one inch from the top of the plate.

18. Remove from tank and dry overnight to prevent ¹⁴C contamination of phosphor-screen.

19. Cover in plastic wrap and expose on a phosphor-screen to visualize ¹⁴C-labeled compounds.

20. To visualize markers, sprinkle crystals of iodine on the bottom of a sealable glass container.

21. Place plates in container and seal lid.

22. Wait 20-30 minutes for entire plate to be exposed.

23. Circle visualized spots as staining will quickly fade.

24. Calculate R_f value by dividing the distance traveled of substance by the distance traveled of solvent front.

4X Tris�Cl/SDS pH 8.8 Buffer

• 91 g Tris base

• 300 mL H₂O

• Adjust to pH 8.8 with HCl

• Add H₂O to 500 mL total volume

• 2 g SDS

4x Tris�Cl/SDS pH 6.8 Buffer

• 6.05 g Tris base

0.4 g SDS

• 40 mL H₂O

• Adjust to pH 6.8 with HCl

• Add H₂O to 100 mL total volume

30% acrylamide/0.8% bisacrylamide

• Store at 4°C in the dark

• 30.0 g acrylamide

• 0.8 g N, N'-methylenebisacrylamide

• Add H₂O to 100 mL total volume

5x SDS Electrophoresis Buffer

• 15.1 g Tris base

• 72.0 g glycine

• 5.0 g SDS

• Add H₂O to 1000 mL total volume

Isopropanol Fixing Solution

• 25% (vol/vol) isopropanol

• 10% (vol/vol) acetic acid

Rapid Coomassie Staining Solution

• 10% (vol/vol) acetic acid

• 0.006% (wt/vol) Coomassie G-250

Destaining Wash Solution

• 10% (vol/vol) acetic acid

Protocol:

1. Make fresh 10% Ammonium Persulfate.

2. Assemble the gel casting apparatus, making sure that the sandwich of glass plates and spacers will make a good seal.

3. Prepare the Separating Gel solution according to the acrylamide concentration needed. Vortex.

Separating Gel

1. Load the apparatus with 4.5 mL of the Separating Gel solution.

2. Top with ~1 mL of Isoamyl alcohol to isolate the polymerization from oxygen.

3. After polymerization, pour off the Isoamyl alcohol, and rinse with distilled water.

4. Remove any water droplets from the inside of the casting apparatus with Whatman paper or a paper towel. Insert the comb for the stacking gel.

5. Prepare the Stacking Gel solution. Vortex.

Stacking Gel (5% acrylamide)

1. Load the Stacking Gel solution, taking care not to introduce air bubbles around the comb (some bubbles can be removed by pipetting up and down).

2. Allow the Stacking Gel to polymerize completely (~45 minutes) before removing comb.

3. Prepare the samples:

   1. Dilute the protein sample 1:1 with 2x SDS Sample Buffer.

   2. Heat the samples and the molecular weight standards for 5 minutes at 100°C.

4. Remove the glass and gel sandwich from the casting apparatus.

5. Clip the sandwich to the electrophoresis apparatus. Carefully remove the comb from the gel and fill the top of the apparatus with 1x SDS Electrophoresis Buffer.

6. Using a 20-gauge needle, flush the wells with buffer.

7. Carefully load the samples into the bottom of the wells using a flat-tipped pipette tip.

8. Fill the bottom of the electrophoresis apparatus with 1x SDS Electrophoresis Buffer and connect the apparatus to the power supply.

9. Run the gel at 10 mA until the dye enters the separating gel. Then increase the current to 15 mA.

10. When the dye reaches the bottom of the separating gel, turn off the power supply, and remove the gel sandwich.

11. Carefully open the sandwich by using one of the spacers to pry the plates apart.

12. Gently cut away the stacking gel and place the separating gel in a small plastic container for staining.

13. Cover the gel with fixing solution and shake gently for 15 minutes.

14. Pour off the fixer and cover the gel with staining solution. Shake gently for at least 2 hours.

15. Pour off the staining solution and cover the gel with the wash solution. Destain for at least 2 hours. (It is usually necessary to change the wash solution at least once)

16. The gel can be stored in water or dried down between sheets of cellulose on a drying frame.

Angela McKay, 22 December 1999

1. ONE ORDER = ONE PLATE = 96 TOTAL SAMPLES ….. (there should be no empty wells).

2. Samples are to be loaded in vertical columns going from A-1 to H-1, A-2 to H-2, A-3 to H-3 and so on till A-12 to H-12 .

3. We must receive the full 12 �l volume of ‘DNA + primer + dI water’ cocktail.

4. Since the sample volume is small, the plates must be ‘V’ bottomed, 200 �l capacity (not 500 �l), stable on bench-top, and well-sealed to withstand cross contamination between wells in transportation from Rosen to Hitchcock.

5. The plates must be CLEARLY LABELLED WITH THE CORRESPONDING ORDER NUMBER. ORDER NUMBERS ARE UNIQUE NUMBERS GENERATED BY THE SOFTWARE. If instead of order numbers, plates bear #1, #2, OR ‘forward,’ ‘reverse,’ etc., THEY WILL NOT BE PROCESSED.

6. Being ‘high throughput’ and fast, we do not want to be tethered to the client by phone/by e-mail following each sample drop-off. Please take the time in your lab to MATCH THE PAPER-WORK WITH SAMPLES. If you are “too rushed” …. STOP …. keep the samples with you!

7. When new users from your group want to use our facility… please, work with them a few times until they are comfortable with these guidelines.

Dec 7, 2004

Start SEQUENCHER

Drag sequences to SEQUENCHER window

Open files by double clicking

Only use files with good signal

Find restriction site of vector (eg. EcoRI GAATTC) with FIND option

Crop vector sequence

Open chromatogram

Find where good sequence ends or poly A tail starts

Crop rest of sequence

Export sequence as Pearson text

One file:

• copy sequence into window at NCBI webpage

• do basic blastn nr search

Multiple files:

• start SEARCH LAUNCHER by dropping sequence files onto the camel symbol

• type DNA

• type 10 (BLASTN NR) or 12 (dbEST)

• results are returned into the SEARCH LAUNCHER directory

• Big Dye Terminator kit from Perkin Elmer

• Gene specific primers (need 3.2 pmol/reaction)

• Sample DNA:

  • 200-300 ng for dsDNA
  • 75-100 ng for ssDNA
  • 90-150 ng for PCR products

• ddH₂O

• Isopropanol

• Mineral Oil

Protocol:

1. Quantify DNA or PCR product using the Spectrophotometer. The protocol applies to a full reaction. In case of a half reaction, divide all volumes in half but DO NOT decrease DNA or primer amounts.

2. Mix sample DNA and specific primers to 12 µl total volume.

3. Add 8 µl Terminator Ready Reaction mix.

4. Mix well and spin briefly (do not vortex).

5. If thermal cycler does not have a heated lid, overlay the reaction mix with 40 µl mineral oil.

6. Put the tubes in thermal cycler and set volume to 20 µl.

7. Program cycle below and repeat for 25 cycles:

   1. In a GeneAmp 9600/9700 or 2400

      1. 96°C for 10 seconds

      2. 50°C for 15 seconds

      3. 60°C for 4 minutes

      4. 4°C soak until needed

   2. In a Thermal Cycler (TC1) or in a DNA Thermal Cycler 480

      1. 96°C for 30 seconds

      2. 50°C for 15 seconds

      3. 60°C for 4 minutes

      4. 4°C soak until needed

8. Spin for 1 minute to remove condensation.

9. Add 20 µl ddH₂O and 60 µl 100% Isopropanol, for 100 µl final volume. (Half reactions: add 30µl ddH₂O instead of 20 µl.)

10. Precipitate at room temperature for 20-30 minutes.

    1. Strip well or 96-well plates:

       1. Spin for 30 minutes at 3000x g

       2. Remove from centrifuge and turn upside down on paper towel

       3. Spin for 1 minute at 700x g to remove residual Isopropanol

       4. Remaining Isopropanol: dry in 37°C oven for 2 minutes (no longer).

    2. Individual tubes:

       1. Spin for 20 minutes at 14000 rpm

       2. Remove the Isopropanol after spinning

       3. Add 250 µl 75% Isopropanol, vortex briefly

       4. Spin for 5 minutes at 14000 rpm

       5. Remove Isopropanol.

       6. Dry in heating block.

11. Fill out sequencing data form.

12. Put the samples in the -20°C freezer by the DNA Sequencing facility.

Lysis buffer:

0.45% Tween, 0.45% NP40, 2.5 mM MgCl₂, 50 mM KCl, 10 mM Tris-Cl pH8.3, 100 µg/µl, Proteinase K

* Add Proteinase K just before use, 5 µl stock per ml of lysis buffer used.

A. Protocol:

1. Wash cells with cold PBS.

2. Resuspend at 10,000 cells/µl in lysis buffer.

3. Incubate at 56°C for 1 hour.

4. Boil for 10 minutes.

5. Store lysate at -20°C

B. Reagents:

L6 buffer:

0.08 M GuSCN (LifeTechnologies GibcoBRL), 0.08 M Tris-Cl pH 6.4, 0.035 M EDTA, 2% (wt/vol) Triton X-100

B. Protocol^*:

1. Wash cells with cold PBS

2. Resuspend at 10⁶ cells/ml in L6 buffer.

3. Add an equal volume of Isopropanol.

4. Spin at 14000 rpm for 30 minutes at 4°C.

5. Discard supernatant.

6. Wash pellet twice with 75% Ethanol.

7. Airdry pellet.

8. Resuspend pellet in 100 µl dH₂O. Store at -20 °C.

* Adapted from Boom et al. J.Clin.Microbiol. 1991, 28:495-503.

• DNA-free^TM, 50 reactions, Ambion #1906, $65

• Oligo dT, 24mer (prep’d by Sherry)

• dNTP Set, 4 x 25 µmol 100 mM, Bioline #BIO-39025, $125

• RNase Inhibitor, 2,000 U, Roche Applied Science #3335399

• SuperScript III Reverse Transcriptase, 2,000 U, Invitrogen #18080-093, $59.40

• Ribonuclease H, 30 U, Invitrogen #18021-014, $99

• TaqMan^� beta-actin Detection Reagents, 100 reactions, ABI #401846, $150

• TaqMan^� Universal PCR Master Mix, No AmpErase^� UNG, 200 reactions, ABI #4324018, $355

Protocol:

DNA digestion:

1. Keep extracted RNA on ice or thaw total RNA on ice (10 pg- 5 µg required total RNA).

2. Thaw DNA-free reagents on ice.

3. Add 0.1v 10 x DNase buffer and 1 µl DNase I to appropriate amount of total RNA and mix by flicking.

4. Incubate 20 minutes at 37°C.

5. Mix DNase Inactivation reagent well. If reagent is difficult to mix, add 1v H₂O/0.1 mM EDTA.

6. Add 0.1v DNase Inactivation reagent.

7. Incubate 2 minutes, flicking intermittently.

8. Spin 1 minute at 10,000 x g to pellet DNase Inactivation reagent.

9. Remove supernatant and use, or store at -70°C.

cDNA synthesis:

1. Keep on ice: oligo DT (20 mM), dNTP (20 mM), 5x SST buffer, DTT, SuperScript III, RNase Out, and DNA digested RNA.

2. To 4 µl DNA digested RNA, add 8 µl of the following mastermix for 1 reaction(s) (enter # of reaction):

   • 1 µl oligo DT (20 µM)
   • 0.5 µl dNTP (20 mM)
   • 6.5 µl ddH₂O

3. Incubate 5 minutes at 65°C.

4. Cool on ice.

5. While cooling, make the following mastermix for 1 reaction(s) (enter # of reaction):

   • 4 µl 5x 1st strand buffer
   • 2 µl 100 mM DTT
   • 1 µl RNase OUT (RNase inhibitor)

6. Add 7 µl of mastermix.

7. Add 1 µl of SSTIII (SuperScript III). Flick and collect.

8. Run sample in thermocycler:

   1. 42°C for 50 minutes

   2. 70°C for 15 minutes

   3. 4°C soak until needed

1. Add 1 µl RNase H to remove complimentary strand.

2. Incubate 20 minutes at 37°C.

3. Estimate cDNA yield using a spectrophotometer.

4. Dilute to appropriate concentration: 5 µl TaqMan template input.

TaqMan:

1. Aliquot 5 µl sample and/or DNA template to optical tubes. Seal with Parafilm.

2. Prepare Mastermix in PCR setup room. Click to download Mastermix Wizard

3. Add 15 µl Mastermix to optical tubes and cap. Keep on ice and transfer to ABI 7700.

4. Flick and spin to collect. Run on ABI 7700.

1. Add 0.7 - 1.0 U of Taq polymerase (Biolase) to PCR product.

2. Mix well. Incubate at 72 °C for 8-10 minutes. Use immediately.

Modified Topo T/A cloning protocol

Preparation:

1. Spread each Carb. plate with 40 µl of 40mg/ml X-gal.

2. Pre-warm plates in warm room.

Ligation:

1. Dilute PCR product 1 in 4 with dH₂O.

2. Combine:
   Topo T/A vector mix 0.25 µl
   PCR product dilution 1.00 µl
   dH₂0 1.25 µl

3. Incubate 5 minutes at room temperature, and then put on ice.

Transformation:

1. Top10 cells should be thawed GENTLY and placed on ice; keep everything cold.

2. Combine:
   Ligation 1.5 µl
   0.25ul β-ME 1.0 µl
   Top10 cells 10.0 µl

3. Stir gently with pipette tip.

4. Chill on ice for 15 minutes.

5. Heat shock in 42°C water bath for 30 seconds.

6. Chill on ice for 2 minutes.

7. Add 125 µl SOC-media and incubate -shaking- at 37°C for 1 hr.

8. Plate the entire transformation on LB-carb + X-Gal plates.

9. Place plates in warm room overnight.

10. When cloning a 750 bp product, this procedure consistently gives 100-200 colonies per plate.

RNA Extraction (QIAgen Viral RNA Kit) (BL3)

When working in the BL3, remember to use extreme care. Clean the workspace with 70% Et-OH before and after use, and make sure that contaminated tubes and tips are neutralized with Westcodyne.

• Check the heat block. Heat to 80°C, if needed.
• Pull the samples from the freezer to thaw.

Buffer AVL precipitates at 4°C after addition of the Carrier RNA.

• Remove Buffer AVL from the fridge and place on the 80°C heating block. Vortex after ~2 minutes. Do not heat for more than 5 minutes, and do not heat more than 6 times.

Carrier RNA dissolved in buffer AVL is stable for up to 6 months at 4°C.

For each quadruple extraction:

• 1 5mL tube to contain the buffered plasma
• 2-4 cryo tubes for the extra plasma aliquots
• labels for the aliquots
• 10 collection tubes
• 1 1.5mL tube
• 1 spin column (in a collection tube)

Before using buffer AVL for the first time, check the buffer for precipitate, and incubate at 80°C, if needed, until precipitate dissolves. Add 1 mL of buffer AVL to the tube of lyophilized Carrier RNA. Dissolve the RNA thoroughly and transfer back to the buffer bottle. Mix thoroughly and aliquot 1.0mL into dated 1.5 mL tubes. Store at 4°C and use within 6 months.

Before using buffers AW1 and AW2 for the first time, add the appropriate amount of Et-OH. Mix thoroughly.

1. All buffers should be at room temperature prior to use.
2. Label the 5mL tubes.
3. Pipet 2240μL of Buffer AVL into each 5mL tube.
4. Add 560μL of the plasma sample. Mix thoroughly by pipetting. (some samples foam at this point)

If cryoprecipitates are present in the thawed plasma sample, they can be pelleted by briefly centrifuging at 6800 x g for 3 minutes. This step will not reduce viral titers.

1. Incubate at room temperature for 10 minutes.
2. Aliquot the remaining plasma, label tubes, and place in freezer.
3. After 10 minutes, add 2240μL 96% Et-OH to the 5mL tube. Mix thoroughly.
4. Remove 630μL from the 5mL tube and apply it to the spin column. Take care to not wet the rim.
5. Spin at 6000 x g for 1 min.
6. Place spin column in a clean collection tube and discard the tube containing the filtrate.
7. Repeat the previous three steps until all the buffered plasma has been applied to the column.
8. Label the 1.5mL tubes.
9. Wash the column with 500μL of Buffer AW1.
10. Spin at 6000 x g for 1 min.
11. Place spin column in a clean collection tube and discard the tube containing the filtrate.
12. Wash the column with 500μL of Buffer AW2.
13. Centrifuge at full speed for 3 minutes. (20,000 x g)
14. Place spin column in a clean collection tube and discard the tube containing the filtrate.
15. Centrifuge at full speed for 1 min.
16. Place the spin column in the labeled 1.5mL tube. Apply 40μL of Buffer AVE directly to the center of the membrane and incubate at room temperature for 1 min.
17. Centrifuge at 6000 x g for 1 min.
18. Apply another 40μL of Buffer AVE to the center of the membrane and incubate at room temperature for 1 min.
19. Centrifuge at 6000 x g for 1 min.

Place the 1.5mL tubes on foil and spray with 70% Et-OH. Make a packet with the foil and spray the outside with 70% Et-OH before removing from the BL3.

In the PCR room, aliquot 25μL of the RNA into labeled 0.6mL tubes using low retention tips.

Viral RNA is stable for up to 1 year when stored at -20°C or -70°C.

Proceed to cDNA reaction for one aliquot immediately following extraction. This avoids a freeze/thaw of our sample and may allow a greater chance of successful amplification.

Whole Genome Reverse Transcription (Invitrogen RT Kit)

1. Mix per sample and preheat RT-PCR machine to 65°C:

   	RNA	~25μL
   	dNTP (20mM)	1.5μL
   	oligo-dT (20pmol/μL)	2.5μL

2. Start file#33 - heat at 65°C for 5 min
3. Reduce heat to 45°C (higher temp will inactivate RT!)
4. Add 20μL of the following pre-warmed!!! mix per sample:

   	5x buffer	8μL
   	0.1M DTT	4μL
   	Superscriptase III	2μL
   	RNase inhibitor	1μL
   	dH2O	5μL

5. Incubate 1.5 hours at 45°C
6. Add additional 1.0μL Superscriptase III, and incubate another 1.5 hours at 45°C
7. Inactivate for 15 min at 70°C
8. Add 1μL RNase H and incubate for 20 min at 37°C
9. Label tube as cDNA and date. Freeze in Walker cDNA box.

Hot Start PCR

dNTPs final concentration: 360 μM

primers final concentrarion: 300nM

MgCl final concentration = 1.75 mM

Cycle Profile: WHOLGENM

SET-UP (individual tubes and paraffin):

1. Place 1mL microfuge tube filled with paraffin in heat block (heated to highest temp), place p200 tip in the wax to preheat (otherwise wax will just solidify in the cold tip)
2. Make lower master mix for “x” number of reactions, keeping all reagents cold on ice.
3. Aliquot 20μL of mix to each PCR reaction tube (use 0.5mL dome-lid thin-wall PCR tubes from Island Scientific)
4. Place lower tubes in the heat block and add 25μL paraffin wax to them – the wax will melt into the correct place
5. As soon as the wax melts, transfer them to your rack to cool (the wax will form a layer over the lower reaction mix, there will be a dimple in the middle of the wax plug but there should be no opening through to your lower reaction mix)
6. Make your upper reaction master mix, keeping all reagents cold on ice.
7. Aliquot 29μL into each reaction tube on top of the wax
8. Add your sample template to each tube (upper mix)
9. Transfer the reactions to your bench to add the control DNA (use 10 copy to measure sensitivity for first and second rounds combined and a 1000 copy control for individual rounds – if you can see a 1000 copy control after a single round, you’re doing GREAT!)
10. Start the PCR machine (MJ) and allow the block to get to 80°C before starting to load your samples

Notes:

• These primers will only work on full-length virus that has both LTRs – they will NOT work on pNL4-3

SET-UP (8-well strip tubes):

1. Place 8 well ultra-thin strip tubes (Island Scientific) into 96-well cold block. Notice the numbering of the tubes and orient correctly.
2. Make lower master mix for “x” number of reactions, keeping all reagents cold on ice.
3. Aliquot 20μL of mix to each PCR reaction tube.
4. Add one Ampliwax pellet into each tube. Place strips in the heat block unti wax melts.
5. As soon as the wax melts, transfer them to your cold block to cool (the wax will form a layer over the lower reaction mix, there will be a dimple in the middle of the wax plug but there should be no opening through to your lower reaction mix)
6. Make your upper reaction master mix, keeping all reagents cold on ice.
7. Aliquot 29μL into each reaction tube on top of the wax.
8. Add your sample template to each tube (upper mix)
9. Transfer the reactions to your bench to add the control DNA (use 10 copy to measure sensitivity for first and second rounds combined (nested) and a 1000 copy control for individual rounds – if you can see a 1000 copy control after a single round, you’re doing GREAT!)
10. Start the PCR machine (PE) and allow the block to get to 80°C before inserting your samples.

PCR Gel Purification and Cloning (Invitrogen XL TOPO PCR Cloning Kit)

Gel Purification:

1. If the PCR product is several days old, add 0.5μL of Bioline biolase and incubate for 20 min at 72°C
2. Prepare 150mL 1% agarose gel TAE buffer, microwave heat for 4 min.
3. Add 90μL of 2mg/mL of crystal violet, pour the gel and put the combs which can hold all PCR(~40μL) products
4. Add 8μL of 6X crystal loading dye to 40μL PCR product
5. Load all PCR products and 4μg HindIII run 100V for around 2 hours (note: skip one lane between each sample when you load the PCR products. It helps you to cut the gel easily without contamination)
6. Cut the right size band, put into the pre-weighted 1.5mL tube and weigh (usually i t weighs 100mg=100μL)
7. Add 250μL (2.5 volumes) of 6.6M sodium iodide and incubate at 42-50°C until the agarose is completely melted
8. Add 525μL (1.5 volumes) of binding buffer and mix well
9. Load all of the mixture onto the column, spin at 3000xg for 30 sec
10. Pour the elution in the collection vial back onto the column and repeat step 9
11. Repeat step 10 one more time to bind all the DNA to the column (a total of 3 times)
12. After the last centrifugation, discard the flow-through in the collection tube
13. Add 400μL of 1X final wash (dilute the 4x wash with ethanol) to the column and spin at 3000xg for 30 sec
14. Repeat step 13 and discard the flow-through in the collection tube after the final centrifugation
15. Spin the column again at 10,000xg for 2 min to dry the column resin
16. Transfer the column to a new 1.5mL tube
17. Add 40μL of TE buffer and incubate at room temp for 1 min
18. Spin at 10,000xg for 2 min
19. Assay 5μL by EtBr agarose gel to estimate the DNA concentration
20. Proceed directly to the TOPO Cloning reaction

TOPO Cloning and Transformation:

1. Set up the following 5μL cloning reaction per sample: | | | | —————————— | —- | | gel purified long PCR products | 4μL | | pCR-XL-TOPO vector | 1μL |
2. Mix gently and incubate for 5 min at room temp
3. Add 1μL of the 6X TOPO cloning stop solution and place on ice
4. Add 2μL of the cloning reaction into a vial of pre-thawed One Shot cells and mix gently (Do not mix by pipetting up and down)
5. Incubate on ice for 30 min
6. Heat shock the cells for 45 sec at 42°C without shaking
7. Immediately transfer the cells to ice and incubate for 2 min
8. Add 250μL of SOC medium
9. Shake the tube horizontally at 37°C for 1 hour
10. Spread 150μL from the transformation on a pre-warmed LB plate containing 50μg/mL Kanamycin
11. Incubate the plate overnight at 30°C

Plasmid mini prep (QIAgen QIAprep Spin Column Miniprep)

Note:

1. After digestion, check the insert by agarose gel. Run gel at 25V overnight
2. Once you have identified the correct clone, make a glycerol stock for long term storage. 500 μL of culture plus 75 μL of glycerol. Mix well and snap freeze in ethanol/dry ice bath.

Plasmid midi prep (Sigma GenElute HP Plsmid Midiprep)

1. Re-plate glycerol stock on LB kanamycin (50μg/mL) plate. Incubate at 30°C overnight.
2. Streak a single colony out and inoculate a 3mL culture for 8-12 hours. Add this culture to 100mL of LB kanamycin (50μg/mL) media, shake overnight at 200rpm in 30°C incubator.
3. Midi prep (see kit protocol)
4. Elute in 1.5mL of dH₂O
5. To check the insert, digest 2μL of DNA by EcoRI
6. After digestion, check the insertion size by 1% agarose gel. Run gel at 25V overnight
7. Determine the concentration by OD260 (1:50 dilution)
8. Dilute to 200 ng/μL or precipitate and resuspend to 200 ng/μL.

Sequencing:

Send 10μL of 200 ng/μL plasmid DNA combined with 7.5μL of 1μM primer in a 96 well plate. This is enough for 2.5 reactions.

1. First round of the nested PCR step of the end point dilution procedure to quantitate the cDNA.

2. First round of the nested PCR step of the limiting dilution step to amplify single templates. The conditions are exactly the same both times.

Reaction Composition

Primer positions are given for NL4-3, and yield a product ~4.6 kb. The enzyme and buffer are from Boehringer Mannheim�s Expand� High Fidelity PCR System.

Cycling Conditions

1. 94°C for 2 min, 30 sec

2. 94°C for 15 sec - 55°C for 45 sec - 68°C for 6 min for 9 cycles

3. 94°C for 15 sec - 57°C for 45 sec - 68°C for 6 min, 20 sec for 19 cycles

4. 72°C for 30 min

5. 4°C soak

Sensitivity

• Presumably one copy of pNL4-3 and one copy of cDNA.

• Provirus (8E5 cells, with one provirus per cell) down to 100 copies.

Specificity

• Nothing detected from uninfected human placental DNA.

• No apparent false priming

Protocol

1. Aliquot 150 µl of binding buffer to 50 µl of PCR product. Thoroughly mix by vigorously pipetting up and down at least 5 times (complete mixing is important).

2. Transfer mixture to 96-well filter plate.

3. Put filter plate with centrifuge alignment frame (Millipore) on top of 96-well catch plate.

4. Spin liquid through filter, into 96-well catch plate (1000x g for 5 min).

5. Discard filtrate, save catch plate for reuse.

6. Add 200 µl of 80% ethanol to each well of filter plate.

7. Spin liquid through filter, into 96-well catch plate (1000x g for 3 min).

8. Discard filtrate, save catch plate for reuse.

9. Repeat 80% ethanol wash (steps 6-8) 1 to 4 times.

10. Do one dry spin to remove residual ethanol (1000x g for 5 min).

11. Add 50 µl of 10 mM Tris-HCl pH 8.0 (preheated to 65°C) to each well. Incubate 1 minute.

12. To elute purified DNA, place the filter plate on top of a clean 96-well catch plate along with a centrifuge alignment frame and spin (1000x g for 5 min)

The PCR product is in the eluent. Transfer 10 µl to a clean catch plate with 10 µl DMSO in each well. Seal plates carefully with aluminium foil. Store both plates at -20°C.

The mapping macro generates one map per freezer box, but it’s quickest to pull the data out by one freezer at a time.

• Log in to Freezerworks. If you don’t know how, you should get help from Tara (queen of the Freezer people)
• From the Samples menu, choose Search by Location
• Select the Freezer you want to export. Leave the Rack, Box, Position boxes blank to select all of the samples in the freezer.
• Open the Import/Export menu and choose Export Data.
• Double-click the Map Maker export format.
• Make sure the Field Delimiter is still tab and the Record Delimiter is return and that Include Header Record is checked.
• Click the Save Export button and note where you save the file for the next step

Creating the Freezer Data File in Excel

Open a new Excel worksheet

Choose Data Get External Data Import Text File

select the freezerworks file you created in step 1

click Finish to accept the defaults and import the data

Fill the empty Subdivision 5 column with spaces:

• enter a space in the top of the column (probably cell C2)
• select that cell and everything below it (shift + cmd + down arrow)
• choose Edit Fill Down

Sort the data by position

• Select all of the data (cmd + A or edit select all)
• Choose Data Sort
• Sort by Subdivision 1 Position, then Subdivision 2 position, then Subdivision 3 Position with a Header row

Create a Map of the Data for a Box

• If you plan to save, create a copy of the MapMaker Blank.xls file. You can find it in the ‘Freezerworks Webinars’ folder on transfer if necessary.
• Copy and paste the rows corresponding to a single box from the freezer worksheet into the ‘Paste Data’ worksheet of the Map Maker file. The shelf column should be blank because we don’t use that subdivision.
• Press ctrl+a to activate the magic. The data in the Paste Data tab will be transformed into a map of the box on the Map tab.
• Print or save as you like. (you may need to redefine the print area to include the line numbers)

For gels with 42 tooth combs:

M A1 B1 A2 B2 � A11 B11 A12 B12 M

M C1 D1 C2 D2 � C11 D11 C12 D12 M

M E1 F1 E2 F2 � E11 F11 E12 F12 M

M G1 H1 G2 H2 � G11 H11 G12 H12 M

For gels with 50 tooth combs:

M A1 B1 A2 B2 � A11 B11 A12 B12 M E1 F1 E2 F2 � E11 F11 E12 F12

M C1 D1 C2 D2 � C11 D11 C12 D12 M G1 H1 G2 H2 � G11 H11 G12 H12

Marker is 1 kb ladder (GIBCO-BRL).

Run approximately 2 hours (bromophenol blue marker 2/3 down lane).

Standard Mix:

Add 48 µl mix to 2µl cells in 96-well PCR plate (ISC, T-3049-1).

Cycling:

When using an Eppendorf repeat pipetter, make enough for 103 reactions and dispense 50 µl per well.

This protocol is also used for the PE 9600. Run takes 4 hours on PE 9700 and more than 4.5 hours on PE 9600.

**
**

GEL LOADING SCHEME

Check PCR products on 1% Agarose gel (2-3 µl PCR product in 15 µl total loading volume)

For gels with 42 tooth combs:

M A1 B1 A2 B2 � A11 B11 A12 B12 M

M C1 D1 C2 D2 � C11 D11 C12 D12 M

M E1 F1 E2 F2 � E11 F11 E12 F12 M

M G1 H1 G2 H2 � G11 H11 G12 H12 M

For gels with 50 tooth combs:

M A1 B1 A2 B2 � A11 B11 A12 B12 M E1 F1 E2 F2 � E11 F11 E12 F12

M C1 D1 C2 D2 � C11 D11 C12 D12 M G1 H1 G2 H2 � G11 H11 G12 H12

Marker is 1 kb ladder (GIBCO-BRL).

Run approximately 2 hours (bromophenol blue marker 2/3 down lane).

1. Fill appropriate number of 96-well plates with 110 µL LB-Amp.

2. Use 96-pin sterile replicators to replicate each original into 2 new plates, A and B.

3. Make sure rows and columns are aligned correctly (this is NOT obvious!).

4. Grow o/n (~ 20 hrs) at 37 °C in humid chamber (wet paper towels in container covered loosely).

5. Log clones that did not grow on appropiate sheet.

6. Include number of plate, date, initials.

7. Seal plates with aluminium foil.

8. Spin plates 10 min at 2000 rpm.

9. Using Transtar 96-well pipet, take off supernatant. Wash Transtar cartridge between aspirating plates as follows:
   Set up 3 pipet tip box lids; one filled with 10% bleach, two with sterile water.

   1. Pipet up/down in 10% bleach.
   2. Rinse by pipetting in first container of sterile water.
   3. Rinse again in second container of sterile water.

10. Add 100 µL LB-Amp/15% glycerol using clean Transtar apparatus.

11. Seal plates with aluminium foil.

12. Vortex briefly to resupend pellet.

13. Store at -80°C, original and plates A for Bumgarner, plates B for Katze/Mullins.

**C
**

1. Fill appropriate number of 96-well plates with 110 µL LB-Amp.

2. Thaw plates B for ~10 min.

3. Spin plates 1 min at 2000 rpm.

4. Use 96-pin sterile replicators to replicate each plate B into 1 new plate, C.

5. Grow o/n at 37°C in humid chamber.

6. Log clones that did not grow on appropriate sheet.

7. Include number of plate, date, initials.

8. Seal plates with aluminium foil.

9. Store at -80°C, plate C for Katze/Mullins

Protocol:

1. Observe membrane and note any abnormalities about growth after spotting. Check pencil numbers and robot puncture marks.

2. Handle membrane with 2 forceps holding it for diagonal corners.

3. Place on Whatman pre-wetted in Denaturing Solution. Leave for 4 minutes.

4. Place membrane on fresh Whatman pre-wetted in Denaturing Solution and transfer to glass plate sitting on empty pipette tip box in boiling waterbath. Leave for 4 minutes with covered lid.

5. Place membrane on Whatman pre-wetted in Neutratlizing Solution. Leave for 4 minutes.

6. Place membrane on dry Whatman. Leave for 1 minute.

7. Submerge membrane under a 600ml pre-warmed (37 °C) PROPK Solution containing ~150mg/ml fresh Proteinase K. Do NOT shake. Leave in incubator for 30-50 minutes.

8. Place membrane on dry Whatman.

9. Cover with a NUNC. Leave overnight.

10. UV cross-link.

11. Store between dry Whatmans.

Denaturation

1. Prepare the following:

25 µg total RNA/ 1µg poly A⁺ RNA x µl

1 µg oligo dT₁₉V (2 µg/µl) 0.5 µl

8 µg oligo dT₃₀ (8µg/µl) 1.0 µl

GFP poly A⁺ RNA (10ng/µl) 0.5 µl

ddH₂O x µl

Final volume 10.5 µl

2. Heat at 70 °C for 10 minutes, cool to 42 °C, slowly.

Note: Heat in 70 °C heat block then take out block and allow to cool on bench top until temp is 42 °C.

Reverse Transcription

3. To sample from above add the following:

dNTP mix (800 µM dATP/dGTP/dTTP, 5 µM dCTP) 1.0 µl

5x First Strand Buffer 5.0 µl

10x DTT 2.5 µl

[α-³²P]-dCTP (10µCi/µl) 5.0 µl

SuperScript II (200 U/µl) 1.0 µl

Final volume 25.0 µl

4. Incubate at 42 °C for 1 hour.

Hydrolysis of RNA

5. Sequentially add the following:

1% SDS 1.0 µl

500 mM EDTA 1.0 µl

2 N NaOH 3.0 µl

6. Heat at 65 °C for 5 minutes

7. Then add the following:

1 M Tris.HCl pH 7.6 10.0 µl

2 N HCl 3.0 µl

8. Incubate at RT for 10 minutes.

9. Add ddH₂O 7.0 µl

Final volume 50.0 µl

10. Purify probe over G-50 Micro Column (Pre-spin col umn at 3500 rpm for 1 minute, apply probe to column, spin at 3500 rpm for 2 minutes.)

Note: Save 1µl for counting and 1µl for denaturing gel.

Prehyb membrane

11. Incubate filter at 65 °C for 6-20 hrs in 10 ml Hybridization solution (5x SSC, 5x Denhardt�s, 0.5% SDS, 100 µg/ml ssDNA)

5ml 10ml 15ml 20ml 25ml 30ml 50ml

20x SSC 1.25 2.50 3.75 5.00 6.25 7.50 12.5

50x Denhardt�s 0.50 1.00 1.50 2.00 2.50 3.00 5.00

20% SDS 0.13 0.25 0.38 0.50 0.63 0.75 1.25

ssDNA 0.05 0.10 0.15 0.20 0.25 0.30 0.50

ddH₂O 3.10 6.20 9.20 12.3 15.4 18.5 30.8

Probe preparation

12. Boil probe 5 minutes, place on ice at least 5 minutes.

13. Add 2 µg poly A₇₂ to 2 ml Hybridization solution.

14. Add denatured probe to the 2 ml Hybridization solution.

15. Incubate 1 hr at 65 °C.

16. Add 3 ml Hybridization solution.

Hyb membrane

17. Incubate filter in 5 ml Hybridization solution for 20 hrs at 65 °C.

Washes

18. Wash membrane 5 minutes at RT in 2x SSC/0.1% SDS.

19. Wash membrane 20 minutes at 65 °C in 2x SSC/0.1% SDS.

20. Wash membrane 1 hour at 65 °C in 0.1x SSC/0.1% SDS.

21 (Optional). If needed, repeat 1 hour at 65 °C 0.1x SSC/0.1% SDS.

Adapted from Huntsman Cancer Institute Katze Lab Protocols

2. Prepare 0.3 to 1 pmole of each Cy³ or Cy⁵ labeled primer in 50µl 1X hybridization solution (50% formamide, 5X SSC, 0.1% SDS, 100µg/ml salmon sperm DNA).

3. Pipet 50µl hyb solution with probe onto long edge of slide.

4. Cover with long cover slip, avoid air bubbles (gives high background).

5. Incubate overnight (12hrs) at room temperature in humid chamber (moist paper towel in bottom of relatively airtight container).

6. To remove coverslip, submerge slide in 2X SSC/0.2% SDS.

Turn on scanner now if you want to scan immediately after processing, scanner needs at least 40 minutes to warm up.

7. Wash 5 min in 2X SSC/0.2% SDS at room temperature.

8. Wash10 min at room temp with 2X SSC/0.1% SDS.

9. Rinse slide 10 seconds in ddH₂0.

10. Dry with compressed air.

11. Store in dark until ready to scan.

12. Scan in Array Scanner II in both channels (make sure scanner has had at least 40 minutes to warm up).

Reagents:

• Forward Gene Specific Primer (IDT)
• Reverse Gene Specific Primer (IDT)
• Random decamer primer (from Ambion RetroScript Kit: 1710, $206.00/kit or Ambion, 5722G, $50.00/80µl)
• RNase Inhibitor (from Ambion RetroScript Kit: 1710, $206.00/kit)
• Reverse Transcriptase (M-MLV) (5x RT Buffer from Ambion RetroScript Kit: 1710, $206.00/kit)
• 10x RT Buffer, otherwise referred to as 10x first strand buffer (from Ambion RetroScript Kit: 1710, $206.00/kit)
• 10x PCR Reaction Buffer (from Ambion RetroScript Kit: 1710, $206.00/kit)
• 50 mM MgCl₂ (from Ambion RetroScript Kit: 1710, $206.00/kit)
• SuperTAQ DNA Polymerase (Ambion, 2050, $48.00/50 U or 2052, $190.00/250U)
• 18S rRNA PCR Primer Pair (Ambion kit, 1716 $155.00/kit)
• Control Template RNA (Ambion kit, 1716 $155.00/kit)

Protocol:

Reverse Transcription

1. Adjust concentration of RNA to 100 ng/µl (The RNA should be DNase treated or equivalent).

2. Set up two 500 µl tubes: mark one tube as (-)RT control – it will have no reverse transcriptase; mark the other with the sample name. Both tubes will will contain the same sample RNA.

3. For each tube mix together:

   RNA (100-450ng) 2 µl
   Ramdom decamer (in excess) 2 µl
   H₂O to equal total volume 8 µl
   Total volume 12 µl
   For a positive control use 2 µl of the RNA Control Template (Ambion).

4. Heat at 75°C for ten minutes; briefly centrifuge and keep on ice 30 seconds or until ready.

5. While heating above, prepare the RT Reaction Cocktail for the sample(s) and the controls (separate):

   Per Sample or (+)RT Control		Per (-)RT Control
   5x RT Buffer	2 µl	5x RT Buffer	2 µl
   2.5mM dNTP	4 µl	2.5mM dNTP	4 µl
   RNase Inhibitor (40 U/µl)	1 µl	RNase Inhibitor (40 U/µl)	1 µl
   M-MLV Reverse Transcriptase	1 µl	H2O	1 µl
   Total Volume	8 µl	Total Volume	8 µl

   Note: When doing multiple reactions, make up a master mix for all samples allowing 10% extra to permit for pipetting errors. Aliquot 8 µl/sample or control and add to the reaction mixture from step 2.

6. Add 8 µl of the RT Cocktail mix to the 12 µl of RNA mix. Mix by pipetting up and down, centrifuge briefly.

7. Incubate at 42°C for 1 hour.

8. Centrifuge briefly and store at -20°C until ready to continue.

Polymerase Chain Reaction

1. For linear range PCR, we find it best to use 10 cycle-increments plus controls.
   Controls are:
   • -a positive RT Control
   • -a negative PCR control to ensure no reagent contaminants
   • -a negative RT sample control (no M-MLV RT) to ensure the RNA used is free of DNA contaminants. The (+) RT and (-) PCR control can be use for an entire experiment, for all conditions.
     The (-) RT sample controls, however, are needed per condition being tested.

1. For each of the controls add 1 µl of the following. | | | | | — | ————————— | ——————————————– | | 1a. | Positive RT Control-Mock | 1µl cDNA from RNA Control Template (Ambion) | | 1b. | Negative PCR Control | 1µl H₂O | | 2a. | Negative RT Control-Mock | 1µl (-)RT Mock cDNA | | 2b. | Negative RT Control-Treated | 1µl (-)RT Treated cDNA |

For Linear Range

1. For each sample, add 1 µl cDNA for a total of 50 µl.
2. Distribute 50 µl each into 10 separate tubes with each representing a different cycle.
3. Set and run the following PCR cycles:
   1. 95°C for 3 minutes
      start cycles:
   2. 95°C for 45 seconds
   3. 58°C for 45 seconds
   4. 72°C for 45 seconds
      REPEAT from step “b” 35 times
      Note: Preheat thermocycler before placing the sample tubes in the machine.

1. Remove the appropriate tube after the designated cycle is over. Ideally you should run a final extension cycle in another thermocycler (10 minutes at 72°C). Put on ice for 1 minute. Keep at 4°C until ready to load into gel. Store PCR product at -20°C.
2. Add 2.5 µl of dye to 10 µl of sample. Run samples on a 2% agarose gel in 1x TAE buffer at 100 Volts until done or at 25 Volts overnight. Stain gel with Ethidium Bromide or Sybr Green.
3. To image on Phosphoimager (Storm): for 100 ml gel, prepare 250 ml 1x TAE buffer with 25 µl Sybr Green stain. (Stain the gel in 1:10,000 dilution Sybr Green stain in 1x TAE buffer.) Shake gently for at least a hour. Sybr Green can be reused.
   Note: Keep the staining solution in the dark by wrapping the container with aluminum foil.
4. Observe gel under UV light and photograph the image. Also, scan the gel under STORM fluorimager.
5. Determine the optimal range by observing the linear range of the gel. Take two points within the optimal range to continue on with the Quantitative RT PCR.

1. Observe gel under UV light and photograph the image. Also, scan the gel under STORM Fluorimager to be able to analyze quantitative differences.

Troubleshooting

Reagents:

• Forward Gene Specific Primer (IDT)
• Reverse Gene Specific Primer (IDT)
• Random decamer primer (from Ambion RetroScript Kit: 1710, $206.00/kit or Ambion, 5722G, $50.00/80µl)
• RNase Inhibitor (from Ambion RetroScript Kit: 1710, $206.00/kit)
• Reverse Transcriptase (M-MLV) (5x RT Buffer from Ambion RetroScript Kit: 1710, $206.00/kit)
• 10x PCR Reaction Buffer (from Ambion RetroScript Kit: 1710, $206.00/kit)
• 50 mM MgCl₂ (from Ambion RetroScript Kit: 1710, $206.00/kit)
• SuperTAQ DNA Polymerase (Ambion, 2050, $48.00/50 U or 2052, $190.00/250U)
• 18S rRNA PCR Primer Pair (Ambion kit, 1716 $155.00/kit)
• 18S PCR Competimers (Ambion kit, 1716 $155.00/kit)
• Sybr Green Stain (FMC Bioproduct, 50513, $146.00/box)

Protocol:

Using the cDNA from the previous RT PCR, optimal cycles were determined for gene of interest. The optimal 18S rRNA PCR Primer:Competimer ratio will need to be optimized per gene primer pair (start with 1:9, 2:8, 3:7 and reduce ratio again if rare primer)

1. Prepare of Primer Mixes (for desired gene) per reaction:

   Forward Primer 2 µl
   Reverse Primer 2 µl
   Total Primer Mix 4 µl

2. Prepare of 10s rRNA PCR Primer:Competimer Mix (e.g., 1:9 Ratio):

   18 S rRNA PCR Primer 1µl
   Competimer 9 µl
   Total 1:9 Mix 10 µl

3. Prepare PCR Reaction Cocktail (ideal to include 4 controls):

   per reaction:
   10x Complete PCR Buffer 5 µl
   2.5 mM dNTP 4 µl
   Taq Polymerase 0.2 µl
   18 S Primer:Competimer Mix 4 µl
   RNase-free H₂O 4 µl
   Total 45 µl
   Mix by pipetting up and down, centrifuge briefly

For your Controls:

Aliquot 45 µl into 4 PCR (0.2 ml) tubes marked C1, C2, C3, C4 (or aliquot 180 µl (45 µl x 4) into a tube with 16ul 18 S primer pair and aliquot 49 µl into 4 tubes)

Add 4 µl 18 S Primer pair to each tube then add 1 µl of the following:
C1 = 1 µl of (+) RT Control cDNA
C2 = 1 µl of (-) RT Mock Control cDNA
C3 = 1 µl of (-) RT LAU Control cDNA
C4 = 1 µl of (-) PCR Control (ddH₂O)
Total reaction mix/tube per tube = 50 µl

Add 4 µl of gene specific primer mix per cocktail mix. Mix well by pipetting up and down.

Aliquot 49 µl into a PCR tubes

Add 1 µl of appropriate cDNA. and mix by pipetting up and down, centrifuge briefly and keep on ice.

Close tube lid tightly and put into PCR machine at 95°C.

Run the tubes at the pre-determined optimal cycles per gene.

Perform PCR under the following conditions:

1. 95°C for 3 minutes
   start cycles:
2. 95°C for 45 seconds
3. 58°C for 45 seconds (check annealing temp for gene)
4. 72°C for 45 seconds
   REPEAT for OPTIMAL CYCLES (pre-determined)
5. 72°C for 10 minutes
6. 4°C Forever

Remove tubes at the appropriately designated cycle and kept on ice or at 4°C until gel can be run.

Analyze 10 µl PCR Product by mixing with 2.5 µl 5x dye in a 2% agarose gel with 3.5 µl Ethinium Bromide in 1x TAE buffer.

• Run for 1.5 hours (or until ready) at 100V or overnight at 25V.
• Stained gel with Sybr Green (250 µl 1x TAE and 25 µl Sybr Green) for 1.5 hours while shaking.

1. Observe gel under UV light and photograph the image. Also, scan the gel under STORM Fluorimager to be able to analyze quantitative differences.

• ddH₂O

• Phenol, water-saturated and buffered (pH 7.5)

• Chloroform

• G25 column

• Linear acrylamide

• 3M Sodium Acetate pH 7.5 and pH 5.2

• Ethanol

• T7 polymerase with 5x reaction buffer and DTT

• Nucleosides

• RQ1 RNase-free DNase

Protocol:

A. Prepare template

1. Adjust volume of template PCR or linearized plasmid to 200 µl with ddH₂O

2. Phenol/Chloroform extract 3x with 100 µl P/C pH7.5

3. Pass through G25 column

4. Add:

   1. 1 µl linear acrylamide

   2. 30 µl Sodium Acetate pH 7.5

   3. 600 µl 100% Ethanol

5. Mix, precipitate at -80°C for 15 minutes.

6. Spin 12 minutes at 14,000 rpm

7. Wash pellet with 70% Ethanol

8. Wash pellet with 100% Ethanol

9. Dry pellet for 10 minutes

10. Dissolve pellet in 11 µl ddH₂O

11. Use 1 µl template to determine concentration.

12. Use 1.5 µg template in 10 µl ddH₂O for transcription reaction.

B. In vitro transcription reaction

1. Make reaction mix:

   1. 38 µl ddH₂O

   2. 20 µl 5x Buffer

   3. 10 µl 100 mM DTT

   4. 5 µl 10 mM rGTP

   5. 5 µl 10 mM rATP

   6. 5 µl 10 mM rUTP

   7. 5 µl 10 mM rCTP

   8. 1 µl RNase Inhibitor

   9. 1 µl T7 polymerase

2. Vortex, spin briefly

3. Add 10 µl template DNA, mix, spin briefly

4. Incubate for 1 hour at 40°C

C. Destroy DNA, purify RNA

1. Add 1 µl RQ1 RNase-free DNase

2. Incubate for 15 minutes at 40°C

3. Add 106 µl ddH₂O

4. Sequentially add the following:

   1. 200 µl Phenol (water-saturated)

   2. 40 µl Chloroform

5. Vortex, spin for 5 minutes at 14,000 rpm

6. Pass the upper aqueous phase through G25 column

7. Precipitate with:

   1. 1 µl linear acrylamide

   2. 30 µl 3M Sodium Acetate pH5.2

   3. 600 µl 100% Ethanol

8. Mix, precipitate at -80°C for 15 minutes.

9. Spin 15 minutes at 14,000 rpm

10. Wash pellet with 70% Ethanol

11. Wash pellet with 100% Ethanol

12. Dry pellet for 10 minutes

13. Dissolve pellet in 11 µl ddH₂O

14. Use 1 µl to determine RNA concentration

Svetlana Mikheeva, 13 August 1999

• 10X buffer

• NotI

• SalI

• ddH₂O

• Agarose

• Phenol

• Chloroform

• Ethanol

• Glycogen

• Sodium Acetate

• Linear Acrylamide

Protocol:

1. Prepare 10 µg plasmid DNA in 5 µl ddH₂O

2. Add:

a. 165 µl ddH₂O

b. 20 µl NE Buffer #3

c. 10 µl NotI

3. Vortex, spin briefly

4. Incubate overnight at 37°C

5. Run 1% agarose gel:

a. 10 µl of reaction (digested plasmid)

b. 1 µl undigested plasmid

c. 1.6 µl 1kb ladder

d. 2.0 µl phi-x174 ladder

6. Continue if plasmid was cut completely

7. Do phenol/chlorofom extraction with 100 µl P/C pH 7.5

8. Pass top layer over G25 column

9. Add:

a. 1 µl glycogen

b. 30 µl 3M Sodium Acetate pH 7.5

c. 600 µl 100% Ethanol

10. Mix, precipitate for 20 minutes at -80°C

11. Spin 12 minutes at 14,000rpm

12. Wash pellet with 70% Ethanol

13. Wash pellet with 100% Ethanol

14. Dry pellet for 5 minutes

15. Dissolve pellet in 170 µl ddH₂O

16. Add:

a. 20 µl NE Buffer for SalI

b. 10 µl SalI

17. Vortex, spin briefly

18. Incubate for 2 hours at 37°C

19. Run 1% agarose gel:

a. 6 µl of reaction (digested plasmid)

b. 1 µl undigested plasmid

c. 1 µl 1kb ladder

d. 1.4 µl phi-x174 ladder

20. Continue if plasmid was cut completely (2 bands)

21. Do phenol/chlorofom extraction with 100 µl P/C pH 7.5

22. Pass top layer over G25 column

23. Add:

a. 1 µl linear acrylamide

b. 30 µl 3M Sodium Acetate pH 7.5

c. 600 µl 100% Ethanol

24. Mix, precipitate for 20 minutes at -80°C

25. Wash pellet with 70% Ethanol

26. Wash pellet with 100% Ethanol

27. Dry pellet for 5 minutes

28. Dissolve pellet in 11 µl ddH₂O

Svetlana Mikheeva, 13 August 1999

**
**

MATERIALS

Equipment

- Single channel pipette: 0.5-10 µl, 10-100 µl, 200-1000 µl, Eppendorf

- Vacuum manifold, Millipore

- Speedvac

- Adjustable waterbaths (37° C, 42° C, 55° C, 100° C)

Disposables

- 96-well Multiscreen-FB filter plate, Millipore, MAFB NOB 10

- Catch plate, VWR, 622409-108

- Pipette tips: 1-10 µl, 2-20 µl, 20-200 µl, 200-1000 µl, ART

- Tubes: 1.5ml

Reagents

- Anchored dT25, dT₂₃VN, 8 µM stock GibcoBRL

- Random 9-mers, NNNNNNNNN, 1 µg/µl stock Gibco-BRL

- GFP poly A⁺ RNA, prepared from plasmid pSP64-GFP

- SuperScript II, GibcoBRL, 200 U/µl, 18064-022 (includes 5X First Strand Buffer and DTT)

- Nucleotides, Pharmacia 27-2035-02, 100mM each*

- 5-(3-Aminoallyl)-2'-deoxyurindine 5'-triphosphate sodium salt (AA-dUTP), Sigma A-0410

- RNase Inhibitor, Boehringer Mannheim 799 017, 40U/ml

- Buffers, Sigma, 2.5M NaOH, 2M MOPS, 1M Tris-HCl pH 7.5 8.5

- 4M Hydroxylamine, Sigma H-2391

- 0.1M NaBicarbonate pH 9.0

- Monofunctional NHS-ester Cy3/Cy5, APBiotech PA23001/PA25001; resuspend each tube in 72µl H₂O, aliquot 4.5µl into 16 tubes, dry in speedvac

- Millipore Binding Buffer (5.3M Gua-HCl in 150mM KAc, pH 4.8)

- Millipore Wash Solution (80% Ethanol)

- Slide pretreatment buffer, 5XSSC/0.2%SDS

- Hybridization Buffer (50% Formamide, 5X SSC, 5X Denhardt�s, 0.1%SDS, 100µg/ml ssDNA (Sigma), 100µg/ml COT-I DNA (BRL), 100µg/ml polyA₇₂)

- Wash buffers, 1XSSC/0.2%SDS, 0.1XSSC/0.2%SDS, 0.1XSSC

* Nucleotide mix (20X): 10mM GTP, 10mM ATP, 10mM CTP, 4mM TTP, 4mM AA-dUTP

PROTOCOL

Reverse Transcription

- Mix together:

2 µg poly A⁺ RNA (or 50mg total RNA)

2 µl oligo dT₂₃VN (8 mM)

2 µl random 9-mers (1mg/ml)

2.5 ng GFP poly A⁺ RNA

10.5 µl total volume

- Incubate at 70° C for 10 minutes, chill on ice 30 seconds, spin

- Add the following:

4 µl 5X First Strand Buffer

2 µl DTT (0.1M)

1 µl Nucleotide Mix (10mM G/A/C, 4mM T, 4mM AA-dUTP)

1 µl H₂O

0.5 µl RNase Inhibitor

- Mix contents of tube gently and incubate at RT for 10 minutes

- Add 1 µl SuperScriptII

20 µl total reaction volume

- Mix contents of tube gently and incubate at 42°C for 2 hours

RNA hydrolysis and purification of cDNA

- Add 2 µl 2.5 M NaOH

- Incubate at 37°C for 10 minutes

- Add 10 µl 2 M MOPS

- Add 200 µl binding buffer to probe and mix

- Dispense into glass fiber filter plate

- Place filter plate on top of vacu-system and apply vacuum.

- Wash 6x with 80% fresh Ethanol

- Place filter plate on top of catch plate along with centrifuge alignment frame

- Do one dry spin to remove residual ethanol (3500 rpm, 5�)

- Add 50 µl H₂O. Incubate 1 minute at RT

- Place filter plate on top of a clean catch plate along with a centrifuge alignment frame and spin (3000 rpm, 5�)

- Repeat with another 50 µl H₂O

- Scan probe at OD 260nm, 550nm and 650nm.

- Dry in Speedvac until volume is less than 5µl (~45 minutes @ 50�C)

Coupling to NHS-ester Cy dyes

- Adjust volume of sample to 4.5µl

- Resuspend mono-functional NHS-ester Cy3 or Cy5 dye aliquot in 4.5µl of 0.1M NaBicarbonate Buffer pH 9.0

- Mix dye and cDNA

- Incubate 1 hr at RT (Note: there is no advantage to incubating longer)

Quenching the Reaction and Removal of uncoupled Cy dyes

- Add 4.5µl of 4M Hydroxylamine

- Add 16.5µl of H₂O to bring the volume to 30µl

- Add 150µl of Millipore binding buffer, purify as above in Millipore 96 well plate, elute twice in 50µl aliquots of H₂O

- Scan probe at OD 260nm, 550nm and 650nm and calculate probe yield, incorporated Cy-dye and specific activity

- Purify probe over G50 column (prespin column (3000 rpm 1�), transfer to new tube, apply probe, spin (3000rpm 2�), collect flow-through).

- Dry purified probe down in speedvac (~1.5 hours at 50 °C)

Hybridization

- Slide pretreatment: submerge mirrored slides for 40 minutes in 5XSSC/0.2%SDS at 55 °C (waterbath), rinse slide by two quick dips in ddH₂O, air dry. Rinse coverslip in ddH₂O and ethanol, air dry

- Resuspend dried down probe in Hybridization Buffer (25µl/reaction)

- Boil probe for 3 minutes, ice 30 seconds, spin briefly

- Apply probe to slide and cover with coverslip

- Incubate overnight (14-16 hrs) at 42 °C in humid chamber

- Preheat wash buffers to 55 °C

- Remove coverslip by immersing slide in 1XSSC/0.2%SDS

- Wash in 1XSSC/0.2% SDS for 10 minutes at RT

- Wash twice in 0.1XSSC/0.2%SDS at RT for 10 minutes

- Wash twice in 0.1XSSC at RT for 1 minute

- Rinse by two quick dips in ddH₂O, dry with compressed air

- Scan (PMT 700, green (532nm), filter 1; PMT700, red (633nm), filter 2; width 10mm, length 60mm).

* Nucleotide mix: always use 10mM dGTP/dATP/dTTP and 1mM dCTP; unlabeled dCTP used in 1:1 ratio with Cy-labeled dCTP.

CY-DYE PROBE SYNTHESIS (17 February 2001)

Protocol:

1. Mix together:

2 µg mRNA

2 µl oligo dT₂₃VN (8 µM)

2 µl random 9-mers (1 µg/µl)

1 µl GFP mRNA (1 ng/µl)

10.5 µl total volume

1. Heat to 70°C for 10 minutes.

2. Chill on ice for 30 seconds.

3. Centrifuge briefly.

4. Add the following:

4 µl 5X First Strand Buffer

2 µl DTT (0.1 M)

1 µl Nucleotide Mix (10 mM G/A/T, 1 mM C)

1 µl Cy3- or Cy5-dCTP (1 mM)

0.5 µl RNase Inhibitor

Note: when doing multiple reactions, make up premix containing all but Cy-dyes and aliquot 7.5 µl premix to each tube before adding Cy-dyes.

1. Mix contents of tube gently and incubate at RT for 10 minutes.

2. Add

1 µl SuperScriptII

20 µl total reaction volume

1. Mix contents of tube gently and incubate at 42°C for 2-3 hours.

2. Denature cDNA/mRNA hybrid as follows:

Add 2 µl 2.5 M NaOH

Incubate at 37°C for 10 minutes

Add 10 µl 2 M MOPS

1. Add 200 µl binding buffer to probe and mix.

2. Dispense into glass fiber filter plate.

3. Place filter plate on top of vacu-system and apply vacuum.

4. Wash 6x with 200 ml 80% Ethanol.

5. Place filter plate on top of catch plate along with centrifuge alignment frame.

6. Do one dry spin to remove residual ethanol (3500 rpm, 5 min).

7. Add 50 µl 10 mM Tris-HCl, pH 8. Incubate 1 minute at RT.

8. Place filter plate on top of a clean catch plate along with a centrifuge alignment frame and spin (3000 rpm, 5 min).

9. Repeat with another 50 µl Tris-HCl.

10. Scan probe at OD 260 nm, 550 nm and 650 nm and calculate probe yield, incorporated Cy-dye and specific activity.

11. Purify probe over G50 column (prespin column (1000x g 1 min), transfer to new tube, apply probe, spin (1000x g 2 min), collect flow-through).

12. Dry purified probe down in speedvac (1 hour at 50°C).

13. Rinse slides and coverslips by two quick dips in ddH₂O, air dry.

14. Resuspend dried-down probe in 25 µl volume of hybridization solution (50% formamide, 5x SSC, 5x Denhardt�s, 0.1% SDS, 100 µg/ml poly A₇₂, 100 µg/ml human CotI DNA; pass through 0.2 µm filter).

15. Boil probe for 3 minutes, ice 30 seconds, spin briefly.

16. Combine with appropriate reaction; total volume is now 50 µl.

17. Apply probe to slide and cover with coverslip.

18. Incubate overnight (14-16 hrs) at 42°C in humid chamber.

19. Preheat wash buffers to 55°C.

20. Remove coverslip by immersing slide in 1x SSC/0.2% SDS.

21. Wash in 1x SSC/0.2% SDS for 10 minutes at RT.

22. Wash twice in 0.1x SSC/0.2% SDS at RT for 10 minutes.

23. Wash twice in 0.1x SSC at RT for 1 minute.

24. Rinse by two quick dips in ddH₂O

25. Dry with compressed air.

26. Scan (PMT 600, green (532nm), filter 1; PMT650, red (633nm), filter 2; width 10mm, length 60mm).

PS. Name Fluorescence Solution

Cy3 = green = pink

Cy5 = red = blue

20X SSC (3M NaCl, 0.3M NaCitrate, pH 7.0):

- adjust pH to 7.0 with 1M HCl

100X Denhardt:

- filter sterilize

- store at �20 °C in 25ml aliquots

Hyb Solution (5X SSC, 5X Denhardt, 50% Formamid, 1% SDS)

Protocol:

1. Rinse gel with ddH₂0, 3X.
2. Soak in 20X SSC for 45 minutes.
3. Take photograph of gel.
4. Soak nylon membrane -cut to size- in ddH₂O for 5 minutes.
5. Put sponge in container, fill with 20X SSC halfway up sponge.
6. Put 3 20X SSC-soaked GB002-sheets on top of sponge.
7. Place gel on top, remove bubbles.
8. Cover with nylon membrane, remove bubbles.
9. Successively add 1 GB002, 4 GB003 and 4cm GB004.
10. Cover with glass plate and 0.4kg weight.
11. Transfer overnight.
12. Take structure apart, mark wells on membrane.
13. Visualize and mark rRNA bands and RNA MW ladder on membrane.
14. Rinse membrane in 2X SSC.
15. Dry on GB003 and wrap in plastic foil
16. UV cross-link (�Autolink� on Stratalinker).
17. Take photograph of flattened gel to assess transfer efficiency.
18. Pre-hybridize membrane for 4-20 hours in 5-10 ml Formamid (Pre-) Hybridization solution (FPH) at 42 °C.
19. Boil 100µl probe for 10 minutes (use 1 x 10⁶ cpm/ml FPH).
20. Cool on ice, spin.
21. Add to hybridization bag.
22. Incubate 20 hours at 42 °C.
23. Rinse in 2X SSC/0.1% SDS at RT, 3X.
24. Wash in 0.2X SSC/0.1% SDS for 15 minutes at 42 °C, 2X.
25. Wash in 0.1X SSC/0.1% SDS for 15 minutes at 65 °C, 2X.
26. Rinse in 2X SSC.
27. Wrap in plastic foil.
28. Expose to phosphoscreen.

Notes:

• After overnight exposure 5pg RNA can be detected with a probe labeled to a specific activity of 10⁹ dpm/mg.

• Probes labeled to ≥5 x 10⁸ dpm/µg should detect transcripts that represent 0.01% of mRNA population with a blot of 10 µg total RNA or 0.0002% of mRNA population with a blot of 3 µg poly(A)⁺ RNA.

• For stripping poor boiling 0.05% SDS on membrane, incubate for 10 minutes, repeat up to 3X. Rinse with 2X SSC.

Combine reagents listed below:

Primer VNG26 (30 µM) 1.0 µl

Template (100ng) 3.0 µl

10x PCR Buffer 5.0 µl

MgCl₂ (25mM) 3.0 µl

10X dNTP�s^* 5.0 µl

³² P dCTP (~10 µCi/µl) 10.0 µl

Water 22.8 µl

Taq polymerase 0.2 µl

Final Volume 50.0 µl

*10X dNTP stock: 2 mM dGTP/dATP/dTTP and 12 µM dCTP. Final concentration in the PCR reaction is: 0.2 mM dGTP/dATP/dTTP, and 0.0012 mM dCTP. Recipe: combine 5 µl 10mM dGTP, 5 µl 10mM dATP, 5 µl 10mM dTTP and 10 µl 30 µM dCTP for 25 µl total volume.

PCR cycles:

5 min at 95°C 1X

45 sec at 95°C

45 sec at 50°C 40X

4 min at 72°C

10 min at 72°C 1X

hold at 4°C

Purify the hot PCR product over a G50 column.

Count 1 µl: PCR counts should range ~2-3 x 10⁶ cpm/µl

(PRE) HYBRIDIZING THE PCR PROBE

Prehybridization:

1. Place blot in hybridization tube: add 6-10ml prehyb/hyb solution.

2. Place tube in 42°C, preheated, hybridization oven. Turn rotator to the �8� setting. Always include a balance tube.

3. Incubate for 3-6 hours.

Hybridization:

1. Boil labeled probe for 2 minutes. Chill on ice for 2 minutes, and add to the hybridization solution. Mix well before pouring the solution into the tube containing the blot. Use 6ml of solution with at least 2 x 10⁶ cpm/µl of probe (best to use entire probe for 6ml hyb, i.e. 2 x 10⁷ cpm/µl).

2. Pour prehybridization solution out of the hybridization tube and add the hybridization solution containing the probe.

3. Incubate in the hybridization oven at 42°C, rotating, overnight.

4. Rinse blot 1X quickly at room temp in 2xSSC/0.05%SDS.

5. Wash 1X for 20 minutes at room temp in 2xSSC/0.05% SDS.

6. Wash 1X for 30 minutes at 50°C in 0.1xSSC/0.1% SDS.

7. Wrap in Saran while the blot is still damp, and expose with a phosphor image screen.

Purchasing Bacterial Clones for Northern Verification:

Purchase the clones by their IMAGE ID number. The vendor is Research Genetics (phone number 1-800-533-4363) The cost is $45 for sequence verified clones.

Search engine with more clone info: http://www.resgen.com/resources/apps/cdna/index.php3 (Type in the IMAGE ID).

Image website: http://image.llnl.gov/

• 25-50ng of target DNA in no more than 25µl TE buffer.

• Ready.To.Go DNA Labelling Kit (-dCTP), Pharmacia, 27-9251-01

• ProbeQuant G-50 Micro Columns, Pharmacia, 27-5335-01

• ddH₂O

• 5ml scintillation fluid in vial.

Protocol

Probe synthesis

1. Reconstitute the contents of the Reaction Mix tube by adding 20µl ddH₂O. DO NOT MIX. Let sit on ice for 5-60 minutes.

2. Denature 25-50ng DNA by heating for 2-3 minutes at 95-100 °C. Immediately place on ice for 2 minutes, then centrifuge briefly.

3. Add the following to the reconstituted Reaction Mix tube:

Denatured DNA (25-50ng) 25µl

[a-32P]dCTP (3000 Ci/mmol) 5µl (50µCi)

ddH₂O to total of 50µl

4. Mix by gently pipetting up and down several times. Bubbles may be removed by a pulse centrifugation.

5. Incubate at 37 °C for 5-15 minutes. (Difficult templates may require up to 30 minutes.)

Note: The Reaction Mix contains dATP, dGTP, dTTP, FPLC-pure Klenow fragment (4-8 units) and random oligonucleotides, primarily 9-mers.

Probe purification

6. Resuspend the resin in spin column by vortexing.

7. Loosen the cap one-fourth and snap off the bottom closure.

8. Place the column in a 1.5ml screw-cap tube.

9. Pre-spin the column for 1 minute at 735 x g (3500rpm).

10. Place the column in a new 1.5ml tube and slowly apply 50µl of the sample to the top-center of the resin without disturbing the resin-bed.

11. Spin the column at 735 x g for 2 minutes. The purified probe is collected in the bottom of the support tube. Cap the tube. Store at �20 °C until use.

Note: For a force of 735 x g the appropriate speed can be calculated from the following formula: rpm = (1000) (657/r)^½ . For example with a rotor radius of 73mm, the appropriate speed would be 3000rpm.

Probe quantification

12. Resuspend 1µl of purified probe in 50µl ddH₂O.

13. Transfer mixture to a vial with 5ml scintillation fluid.

14. Count the samples (as user 7, T-wing).

Note: this protocol should label 25-50ng of DNA to 1 x 10⁹ dpm/µg. Yields are usually 10⁶ cpm/µl.

Probe qualification

15. Run 20,000 cpm probe on a 1% Agarose gel.

16. Place gel on 4 pieces of Whatman paper.

17. Cover just the gel with piece of Saran Wrap.

18. Dry down gel at 65 °C for 1 hour.

19. Expose phosphoscreen.

Note: PCR products should give one sharp band.

Reduced Formaldehyde denaturing gel (1% Agarose, 1x MOPS, 1.9% di-F)

25x MOPS (2 M MOPS, 500 mM NaOAc, 10 mM EDTA)ddH₂O

Denaturing Buffer (1x MOPS, 50% Formamide, 2% Formaldehyde)

Blue Juice (50% Glycerol, 0.27% BPB/XC, 1.3 mM EDTA)

Ethidium Bromide (1mg/ml)

� Blue Juice and Ethidium Bromide are added in 2:1 ratio.

� 100 ml gel: 50 µl sample (6 µl RNA + 30 µl denaturing buffer + 9 µl BJ/EB)

Protocol:

1. Dissolve agarose in MOPS and H₂O, cool to handwarm.

2. Add 37% di-Formaldehyde, poor gel, let solidify.

3. Flush wells after removal of comb.

4. Running buffer is 1x MOPS.

5. Add denaturing buffer to RNA samples in 5:1 ratio.

6. Incubate at 65°C for 15 minutes.

7. Cool on ice.

8. Add Blue Juice/Ethidium Bromide (2:1) to samples in 1:4 ratio.

9. Load on gel (max. 15 µl on 20ml gel, max. 50 µl on 100ml gel).

10. Run for 3 hrs at 75V.

Notes:

- Run 6 µg of RNA MW ladder along with samples.

- Optional: run ³²P labelled l/HindIII (10000 cpm) with samples.