PROTOCOL:

*For figures and references, please check the paper (http://www.jove.com/video/52610) or the video

This protocol is also available as a Word document.

**
**

1) Construction of chimeric HIV-1 NL4-3 molecular clones

1.1) Amplify insert DNA fragment

1.1.1) Design chimeric primers. The 5' halves of both forward and reverse primers contain an HIV-1 vector sequence, at which the fragment will be inserted. The 3' half of the primers must contain the end of the insert sequence (Figure 2). Make sure that the chimeric primer sequence retains the original open reading frames.

1.1.1.1) Use primers at least 20 bases in length, with a melting temperature greater than or equal to 60 °C, ~50% GC content, and a low tendency to form primer dimers, heterodimers and/or hairpin structures. These properties can be assessed using the OligoAnalyzer web tool (https://www.idtdna.com/analyzer/Applications/OligoAnalyzer/)

1.1.2) Use PCR²⁷ and the chimeric primers to amplify insert DNA (Figure 2). For each PCR reaction, use 1X high fidelity buffer, 0.2 mM dNTPs, 1 U high fidelity DNA polymerase, 0.5 µM of forward chimeric primer, 0.5 µM of reverse chimeric primer, and 1 pg - 10 ng of DNA sample carrying insert region. Add dH₂O to a final volume of 50 µl.

1.1.3) Set thermal cycling steps as follows: Perform an initial DNA denaturation step at 98 °C for 10 sec. Amplify with 30 cycles of DNA denaturation at 98 °C for 10 sec and DNA annealing at 3 °C above the lowest melting temperature of the two primers for 20 sec. Perform a final extension at 72 °C for 10 min. Store PCR products at 4 °C.

1.1.4) Take 5 µl of the PCR products from the previous step and run agarose gel electrophoresis²⁸.

1.1.4.1) Use a 0.7% agarose gel, 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA), 0.5 μg/ml ethidium bromide (EtBr) final concentration and 1 kb ladder as the DNA size marker. Set power source voltage to 5 V/cm distance between electrodes. Stop the electrophoresis when the loading dye migrates through about 2/3 of the gel length. Visualize the gel using a gel documentation system²⁸.

Note: EtBr is a suspected carcinogen and must be properly disposed of, per institution regulations. Gloves should always be worn when handling gels containing EtBr. Change to new gloves after finish handling EtBr containing material and before handling other materials or equipment to prevent cross contamination.

1.1.5) If only one DNA band with size corresponding to the desired PCR product is detected, purify the rest of the PCR product using a commercial kit such as QIAquick PCR Purification Kit according to the manufacturer’s protocols.

1.1.5.1) If other, non-specific bands are also present, use the rest of the PCR product to run preparative gel electrophoresis. Use the same parameters and conditions specified in step 1.1.4. Ensure that the gel well is large enough to load ~45 µl of PCR products. Cut out the band of interest and extract the DNA from the gel using QIAquick gel extraction kit according to the manufacturer’s protocols.

1.2) Introduce the insert fragment into full-length infectious HIV-1 subtype B vector (pNL4-3)

1.2.1) Use purified PCR products from step 1.1.5 as PCR primers. Use pNL4-3VifA²⁰ as template DNA in one PCR reaction and use pNL4-3VifB²⁰ as template in the other reaction (Figure 2). For each PCR reaction, use 1X high fidelity buffer, 0.2 mM dNTPs, 2 U high fidelity DNA polymerase, 500 ng of primer DNA and 50 ng of template DNA in a final volume of 50 µl. Set the thermal cycling parameters to: 98 °C for 30 sec, 35 cycles at 98 °C for 10 sec, 48 °C for 1 min and 72 °C for 10 min, followed by 72 °C for 10 min.

1.2.2) Add 10 U of DpnI to 50 µl of the PCR reaction and incubate at 37 ^oC for 1 hr to digest the template DNA. Ensure that the plasmid DNA is isolated from a methylation competent bacterial strain, e.g., TOP10 chemically competent Escherichia coli.*

*

1.2.3) Use DpnI digested product to transform competent bacterial cells. Use heat-shock transformation with TOP10 chemically competent E. coli, according to the manufacturer’s protocol. To select for bacterial cells containing the recombinant plasmid, use Luria Broth (LB) culture plates containing 100 mg/L carbenicillin.

1.2.3.1) Pick ~10 well-separated colonies and grow each separately in 3 ml LB liquid medium containing 100 mg/L carbenicillin and incubate at 30 °C in a shaker overnight.*

*

1.2.3.2) Use QIAprep Spin Miniprep kit to isolate plasmid DNA from the bacterial liquid culture, according to the manufacturer’s protocol.

1.2.4) Use double restriction digestion²⁹ to determine whether the plasmid DNA contains the proper ** insert. Ensure that one of the restriction sites exists only within the insert region and the other restriction site exists only once in the HIV-1 vector, outside of the insert region.

1.2.4.1) Digest at least 300 ng of plasmid DNA in a 10 µl final reaction volume. Select restriction buffers, incubation temperature and incubation time according to the manufacturer’s protocol of the selected restriction enzymes. Take 9 µl of the digested DNA and run gel electrophoresis as described in step 1.1.4. Select recombinant plasmids that have DNA bands of the predicted sizes.

1.2.5) Confirm sequence integrity of the recombinant plasmids by Sanger sequencing. While rare, unwanted mutation(s) can be introduced during the PCR reactions.

1.2.5.1) Sequence both strands of the plasmid DNA. Follow instructions in step 1.1.1.1 to design sequencing primers. In addition, ensure that the forward and reverse sequencing primers anneal at least 50 bp upstream and downstream of the insert region in the recombinant plasmid, respectively.

1.2.5.2) Submit plasmid DNA and sequencing primers to a commercial DNA sequencing service provider. Prepare DNA sample and primers as specified by the service provider.

1.2.6) Make an endotoxin-free stock of the mutated plasmid DNA using an Endotoxin free plasmid DNA kit according to manufacturer’s protocol. Prepare at least 1 µg of endotoxin-free plasmid DNA for transfection in the following step.

1.3) Introduce small-scale mutations via site-directed mutagenesis

1.3.1) Design mutagenic primers with overlapping forward and reverse primers containing the desired mutation(s). Position the base(s) to be substituted, inserted, or deleted in the middle of the primers, flanked by 10-15 homologous bases. Follow instructions in step 1.1.1.1.

1.3.2) Use PCR to synthesize mutant plasmids. For each PCR reaction, use 1X high fidelity buffer, 10 mM dNTPs, 2 U of high fidelity DNA polymerase, 0.5 µM of forward mutagenic primer, 0.5 µM of reverse mutagenic primer and 50 ng of chimeric pNL4-3VifB, from step 1.2.6, in a final volume of 50 µl. Set the thermal cycling parameters to: 98 °C for 30 sec, 25 cycles at 98 °C for 10 sec, 48 °C for 1 min and 72 °C for 10 min, followed by 72 °C for 10 min.

1.3.3) Repeat step 1.2.2 to 1.2.6.

2) Generation of viral stock using transfection

2.1) Calculate the amount of viral stock desired and plasmid DNA required. With a viral titer of 10⁴ IU/ml or higher, 1.8 ml of viral stock is sufficient for two sets of growth competition assays, including monoinfections, each done in triplicate. For a transfection done in a 6-well plate, about 1.8 ml supernatant is harvested per well. One µg of plasmid DNA is needed for each transfection done in a 6-well plate.

2.2) For each well of a 6-well plate, prepare 100 µl of transfection mixture, e.g., consisting of 1 µl X-tremeGENE 9 transfection reagent (or comparable product), 1 µg of plasmid DNA and serum-free DMEM.

2.2.1) Determine the volume of plasmid DNA needed, using 1 µg plasmid DNA per well. Ensure that the final concentration of the plasmid DNA is at least 50 ng/µl.

2.2.2) Determine how much serum-free medium (DMEM) is needed per well using the formula: Total volume of DMEM in µl = 100 µL - DNA volume in µl.

2.3) Add 10⁶ HEK 293T-17 (ATCC) cells/well in 2 ml of propagation medium (DMEM + 10% fetal bovine serum (FBS)) into a 6-well plate. Incubate for 1 hr at 37 ^oC in a 5% CO₂ atmosphere. Seed as many wells as needed (determined in step 2.1).

2.4) To prepare the transfection mixture, aliquot the appropriate volume of serum-free DMEM, as calculated above, into a 1.8 ml polypropylene microcentrifuge tube, and then add the transfection reagent.

2.4.1) Pipette reagent directly into the media solution, do not add it to the plastic surface of the microcentrifuge tube. Add plasmid DNA last. Pipet up and down gently to mix the solution. Incubate for 15 min at room temperature (15 ^oC to 25 ^oC) to allow the formation of transfection complexes.

2.4.2) Add the mixture in a drop-wise manner to cells seeded in the 6-well plate. Gently shake or swirl the wells to ensure even distribution of transfection complexes.

2.4.3) Seal plates with plastic wrap.

2.5) Incubate cultures at 37 ^oC in a 5% CO₂ atmosphere for 48 hr.

2.6) Use a pipette to carefully collect and transfer supernatant to a 15 ml tube through a 0.22 µm filter top.

2.7) Use pipette to transfer 250 µl or more of the filtered supernatant to 1.8 ml microfuge tubes with rubber gaskets in the lids.

2.8) Store filtered supernatants at -80 ^oC until use.**

3) Determine infectious titer of viral stocks on peripheral blood mononuclear cells (PBMCs)

3.1) Stimulate PBMCs with phytohemagglutinin (PHA). Per one viral stock, seed 2 x 10⁶ PBMCs in complete Iscove’s Modified Dulbecco’s Medium (cIMDM; IMDM supplemented with 20 U/ml of human interleukin 2 (hIL-2), 10% fetal bovine serum and 1% penicillin/streptomycin) supplemented with PHA (1.5 µg/ml). Seed PBMCs at 2 x 10⁶ cells/ml. Incubate PBMCs at 37 ^oC in a 5% CO₂ **** atmosphere **** for 72 hr.

3.2) Harvest PHA stimulated PBMCs. Transfer non-adherent PHA-PBMCs to a 50 ml conical tube. Spin tube at 228 x g for 10 min. Carefully remove supernatant without disrupting the cell pellet. Re-suspend the cell pellet to a final concentration of 2 x 10⁵ PBMCs/ml in cIMDM.

3.3) Seed 2x10⁴ PHA stimulated PBMCs/well in 100 µl/well cIMDM in a round bottom 96-well plate.

3.4) Make a 1:10 dilution of the viral stock. Then, from the first diluted stock, make twelve 3-fold serial dilutions in a 96-well master plate. This dilution scheme is recommended for detecting viral titers in the range of 10⁴ to 10⁶ infectious unit (IU) per ml. For example, add 20 µl of virus stock to 180 µl media in the 1.5 ml tube. Mix the dilution by pipetting carefully. Then transfer 90 µl of the diluted stock into 180 µl media of the first well and mix well by pipetting. Continue dilution series by transferring 90 µl from the current well to 180 µl media in the next well eleven more times. Increase or decrease the initial dilution if titers higher than 10⁶ IU/ml or lower than 10⁴ IU/ml are expected, respectively.

3.5) Add 40 µl of the serially diluted viral stock from the master dilution plate to the seeded PBMCs plate (from step 3.3) in quadruplicate. Incubate plates at 37 ^oC in a 5% CO₂ **** atmosphere **** for 16-24 hr.

3.6) Carefully remove 100 µl supernatant from each well, and replace with 160 µl fresh cIMDM to a total volume of 200 µl/well. Incubate plates at 37 ^oC with 5% CO₂ **** atmosphere (day 1).

3.7) On days 4, 7, 10 and 13 transfer 100 µl supernatant from each well to 100 µl disruption buffer (2 % TritonX-100 in PBS), and replace with 100 µl fresh cIMDM. Store the supernatants at -20 ^oC.

3.7.1) Keep sampling and adding fresh cIMDM every three days until the titer stabilizes.

3.8) Determine the 50% tissue culture infectious dose (TCID₅₀) of the viral stock by p24 ELISA using the day 7 and 13 samples as described in step 4.

3.8.1) If the TCID₅₀ obtained from day 13 is clearly higher than the titer from day 7, the virus stock may need a longer time to expand. Repeat the p24 ELISA using later samples until the infectious titers from two sampling time points become stable (or decrease). Stocks should be selected from samples with the highest titers.

4) **ELISA (Enzyme-linked Immunoabsorbant assay) detection of HIV-1 p24 for determining viral infectious titer

**Note: The following protocol was developed using p24 antigen capture plates prepared in our laboratory³⁰. Commercial HIV-1 p24 ELISA plate/kits can also be used, following the manufacturer’s protocol.

4.1) Prior to working with samples, prepare working stocks of primary antibody (rabbit anti-HIV-1 SF2 p24 antiserum).

4.1.1) Thaw p24 antiserum at room temperature (RT).

4.1.2) Mix 2.5 ml glycerol with 2 ml 10% FBS in phosphate buffer saline (PBS).

4.1.3) Add 0.5 ml antiserum and mix.

4.1.4) Store 1 ml aliquots at -20 ^oC.

4.2) Thaw samples from step 3.7 in 37 ^oC incubator.

4.3) Wash the p24 capture plate 5 times with wash buffer (1x PBS with 0.05% Tween-20).

4.4) Add 50 µl/well of sample diluent (1% bovine serum albumin (BSA), 0.2% Tween-20 in RPMI-1640), then add 50 µl of sample to appropriate wells. Include at least three wells with sample diluent only as mock / negative controls. Incubate for 2 hr at 37 ^oC or overnight at 4 ^oC.

4.5) Prepare the primary antibody solution fresh before use. Make a 1:2,000 fold dilution of the primary antibody working stocks using the primary antibody diluent (12% FBS in RPMI-1640). Ensure to prepare enough for the use of 100 µl solution per each sample/control well in a 96-well plate.

4.5.1) For example, to make enough solution for one 96-well plate, add 5 µl of the primary antibody working stocks to the primary antibody diluent for a final volume of 10 ml.

4.6) Wash capture plate 5 times with wash buffer.

4.7) Add 100 µl of the primary antibody solution to each well. Incubate for 1 h at 37 ^oC in a 5% CO₂ atmosphere.

4.8) Prepare the secondary antibody solution fresh before use. Make a 1:14,400 fold dilution of the secondary antibody (1 mg/ml Goat anti-rabbit HRP) using the secondary antibody diluent (7 % FBS, 0.01 % Tween-20 in RPMI-1640). To reduce pipetting errors, perform a two-step serial dilution. Ensure to prepare enough for the use of 100 µl solution per each sample/control well in a 96-well plate.

4.8.1) For example, to make enough solution for one 96-well plate, first add 1 µl of the secondary antibody to 99 µl of the secondary antibody diluent. Then add 70 µl of first dilution to the secondary antibody diluent for a final volume of 10 ml.

4.9) Wash capture plate 5 times with wash buffer.

4.10) Add 100 µl of the secondary antibody solution to each well. Incubate for 1 hr at 37 ^oC in a 5% CO₂ atmosphere.

4.11) Wash plate 5 times with wash buffer.

4.12) Add 100 µl of room temperature TMB substrate. Incubate 30 min at room temperature in a closed container to protect from light.

4.13) Add 100 µl of room temperature stop solution (1 N H₂SO₄).

4.14) Read absorbance at 450-650 nm in each well using a microplate reader. Use the absorbance value to score each well as infected or uninfected. A well is considered to contain infectious virus if the absorbance value is at least three times higher than the value read from mock / negative control wells. Calculate TCID₅₀ of the viral stock using the Reed-Meunch method³¹.

5) **Establish viral growth kinetics

**

5.1) Monoinfection

5.1.1) Seed 3x10⁵ PHA-stimulated PBMC/well in 48-well plates in a total volume of 500 µl/well. Keep the culture plates at 37 ^oC in a 5% CO₂ atmosphere until inoculation.

5.1.2) For each virus, prepare an inoculum containing 6,000 IU in 2 ml of cIMDM.

5.1.3) Inoculate wells in triplicate by adding 500 µl of the inoculum (1,500 IU) to the seeded cells. The final volume of the infected cell culture is 1 ml/well and the MOI is 0.005.

5.1.4) Aliquot 200 µl of the remaining inoculum to each of two 96-well plates for RNA isolation, one of which is saved as a backup.

5.1.5) Incubate cultures at 37 ^oC in a 5% CO₂ atmosphere for 16-24 h.

5.1.6) Wash cultures 16-24 h after inoculation.

5.1.6.1) Remove and discard 750 µl of culture supernatant.

5.1.6.2) Add 750 µl of fresh cIMDM. Wrap plates in plastic wrap and spin for 10 minutes at 300 x g. Remove and discard 750 µl supernatant.

5.1.6.3) Add 750 µl of fresh cIMDM. Incubate at 37 ^oC with a 5% CO₂ atmosphere (day 1)**.

**

5.1.7) Sample cultures daily from day 2 to day 7.

5.1.7.1) Transfer 500 µl of culture supernatant to a 1.8 ml centrifuge tube. Spin for 1 min at 3000 x g.

5.1.7.2) Transfer 200 µl of the cell-free supernatant to the two 96-well sample plates for RNA isolation, again saving one plate as backup. Store supernatants at -80 ^oC until RNA isolation.

5.1.7.3) Add 500 µl fresh cIMDM to each culture. Incubate at 37 ^oC in a 5% CO₂ atmosphere.

5.1.7.4) Discard cultures into Wescodyne at the end of the experiment.

5.1.7.5) Isolate RNA from 200 µl of supernatant (use commercial kits such as QIAamp Viral RNA Mini Kit) following the manufacturer’s standard protocol. For a large number of samples, use the Qiagen QIAxtractor.

5.1.7.6) Store RNA samples at -80 ^oC until cDNA synthesis.

5.2) cDNA synthesis (Reverse transcription)

5.2.1) For each RNA sample, add 1.2 nmol of dNTP and 1.2 pmol of cDNA synthesis primer, (5'-GTTGATCCTTTAGGTATCTTTCCACAGC-3', HXB2 nucleotide 7968 to 7995) to 10 µl of viral RNA. Add water to a final volume of 14 µl. Flick the tube to mix and spin briefly to collect liquid at the bottom of the tube.

5.2.2) Incubate mixture for 5 min at 65 ^oC, then hold at 4 ^oC until the master mix is prepared.

5.2.3) Prepare master mix using 5x first-strand buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl₂), 5 mM DTT, 120 U of SuperScriptIII and 240 U of Rnase inhibitor. Add water to final volume of 10 µl.

5.2.4) Add 10 µl of master mix to RNA mixture, flick to mix and spin to collect.

5.2.5) Incubate mixture for 90 min at 50 ^oC to allow synthesis of cDNA. Incubate for 15 minutes at 70 ^oC to inactivate reverse transcriptase. Hold at 4 ^oC as needed.

5.2.6) Add 2 U of Rnase H, flick to mix, and then spin to collect.

5.2.7) Incubate 20 min at 37 ^oC. Store cDNA at -20 ^oC.

5.3) **cDNA quantitation using qPCR system

**

5.3.1) Prepare a standard dilution series. Do 10-fold serial dilution, from 3 x 10⁶ copies/µl down to 30 copies/µl, of pNL4-3VifA. Use distilled water for dilutions. Prepare the standard dilution series fresh before use or prepare small batches and keep at -20 ^oC. Do not freeze-thaw the standards more than three times.

5.3.2) Set up a 96-well qPCR reaction plate. Ensure that each plate contains at least one well of negative controls, a triplicate of the standard dilution series, and at least a duplicate of each cDNA sample.

5.3.3) For each qPCR reaction, use 12.5 µl of qPCR master mix, 0.2 µM probe, 0.8 µM each of the forward and reverse primers and 1 µl of cDNA or the standard dilution series or water/buffer (for the negative control well). Add water to a final volume of 25 µl. The qPCR probe is light sensitive. Keep it in closed container.

5.3.3.1) To detect cDNA derived from pNL4-3VifA based molecular clone, use the VifA primer-probe: VifAB forward primer (GGTCTGCATACAGGAGAAAGAGACT), VifA reverse primer (5'-AGGGTCTACTTGTGTGCTATATCTCTTTT-3') and VifAB probe (6FAM-5'-CTCCATTCTATGGAGACTC-3'-MGBNFQ). For cDNA derived from pNL4-3VifB based clone, use the VifB primer-probe: VifAB forward primer, VifAB probe and VifB reverse primer (5'-CACCTGCGTGCTATACCTTTTCT-3').

5.3.4) Set PCR cycling parameters to 50 ^oC for 2 min, 95 ^oC for 10 min, and 40 cycles of 95 ^oC for 15 sec and 60 ^oC for 1 min. Consult the manufacturer’s support document for operation of the qPCR machine.

5.3.5) Calculate a standard curve using data from the triplicate standard dilution series. Compare amplification data of the cDNA sample to the standard curve to determine the copy number. Consult the manufacturer’s support document for data processing.

5.4) **Determine viral exponential growth phase

**

5.4.1) Plot viral growth kinetics with the sampling day along the X-axis and the cDNA copy number along the Y-axis and identify the viral exponential growth phase, i.e., when viral cDNA copy numbers increase in an exponential progression.

5.4.2) Use the GRC web tool (http://indra.mullins.microbiol.washington.edu/grc/) to calculate viral growth rate (g). In this application, the GRC tool accepts cDNA copy numbers from at least two time points as input, and outputs the viral growth rate (g). Use only time point data within the exponential growth phase (see step 5.4.1 above) to obtain accurate growth rates. For a detailed description of the mathematical model used in the GRC web tool, see²⁰.

6) **Growth Competition Assay

**

6.1) Seed 3 x 10⁵ PHA-stimulated PBMCs (or 1 x 10⁵ CEMx174 cells) in 500 µl total volume per well in a 48 well flat-bottomed plate.*

*

6.2) Keep plate in 37 ^oC in a 5% CO₂ atmosphere until inoculation.

6.3) For each virus, prepare 3 ml of inoculum containing 6,000 IU.

6.4) Transfer 1.5 ml of each viral inoculum to a sterile tube to create the dual infection inoculum. Add 500 µl of the dual inoculum (1,500 IU) to 3 x 10⁵ cells in a 48-well plate. The final culture volume is 1 ml/well. Aliquot 200 µl of the inoculum to two 96-well plates for RNA isolation; save one plate as a back up.

6.5) Incubate inoculated cells at 37 ^oC with a 5% CO₂ atmosphere for 16-24 hr.

6.6) Wash cultures 16-24 h after inoculation.

6.6.1) Remove and discard 750 µl of culture supernatant.

6.6.2) Add 750 µl of fresh cIMDM. Wrap plates in plastic wrap and spin for 10 minutes at 300 x g. Remove and discard 750 µl supernatant.

6.6.3) Add 750 µl of fresh cIMDM. Incubate at 37 ^oC with a 5% CO₂ atmosphere (day 1).

6.7) Select sampling times to include at least 3 time points within the exponential growth phase observed in step 5.4.1.

6.7.1) For each sampling, follow step 5.1.7.

6.8) Perform cDNA synthesis as described in section 5.2.

6.9) Determine the viral variant ratio using qPCR.

6.9.1) Prepare a standard serial dilution series in triplicate, diluting 10-fold in each step from 3 x 10⁶ copies/µl to 30 copies/µl of pNL4-3VifA.

6.9.2) Set up a 96-well qPCR reaction plate. Ensure that each plate contains at least one negative control, the standard dilution series in triplicate, and duplicates of each cDNA sample.

6.9.3) For each qPCR reaction, use 12.5 µl of qPCR Master Mix, 0.2 µM probe, 0.8 µM each of the forward and reverse primers and 1 µl of cDNA or the standard dilution series or water/buffer (for the negative control wells). Add water to a final volume of 25 µl. The qPCR probe is light sensitive, keep it in closed container.

6.9.3.1) Use the VifA primer-probe to detect signals in the negative controls and the standard dilution series and with one duplicate of the cDNA sample. Use the VifB primer-probe with the other duplicate of the cDNA sample.

6.9.4) Set PCR cycling parameters to 50 ^oC for 2 min, then 95 ^oC for 10 min, and then 40 cycles of 95 ^oC for 15 sec and 60 ^oC for 1 min. Consult the manufacturer’s support document for operation of the qPCR machine.

6.9.5) Calculate the standard curve using amplification data from the standard dilution series. Compare amplification data of the cDNA samples to the standard curve to determine copy number. Consult the manufacturer’s support document for data processing.

6.9.6) Use the GRC web tool (http://indra.mullins.microbiol.washington.edu/grc/) to calculate relative viral fitness (d). The GRC tool accepts cDNA copy numbers or chromatogram peak heights from at least two time points as the input, and outputs the net growth rate difference (d) between the two viruses. While the tool can calculate the net growth rate from two time point data, it is strongly recommended to input data from three or more time points. Use only data obtained from time points within the exponential growth phase (see step 5.4) to obtain accurate growth rates. For a detailed description of the mathematical model used in the GRC web tool, see²⁰.

6.10) Determine viral ratios using chromatogram peak-heights

6.10.1) PCR amplify HIV-1 vif fragments containing the VifAB sequence tag using VifFwd (5′-GAAAGAGACTGGCATTTGGGTCAGGG-3′; HXB2 positions 5266-5291) and VifRev primers (5′-GTCTTCTGGGGCTTGTTCCATCTGTCC-3′; HXB2 positions 5579-5553).

6.10.1.1) For each PCR reaction, use 1 µl of cDNA, 1X NH₄ buffer, 1.5 mM MgCl₂, 0.2 mM dNTP, 2.5 U of Taq Polymerase, and 0.45 µM of each primer. Add water to a final volume of 50 µl.

6.10.1.2) Set PCR cycling parameters to 3 cycles at 94 ^oC for 1 min, 55 ^oC for 1 min, and 70 ^oC for 1 min, followed by 34 cycles at 94 ^oC for 15 sec, 58 ^oC for 30 sec, and 70 ^oC for 1 min, and then hold at 4 ^oC.

6.10.2) Purify PCR products using the QIAquick PCR purification kit according to the manufacturer’s protocol.

6.10.3) Submit purified PCR products to a DNA sequencing service provider for Sanger sequencing.

6.10.4) Check the average read quality score, which should be provided by the sequencing service. If the average base call accuracy is less than 85%, redo step 6.10.1 to 6.10.3

6.10.5) Use the ChromatQuant web tool (http://indra.mullins.microbiol.washington.edu/cgi-bin/chromatquant.cgi) to calculate viral ratio at each time point. The tool requires the sequence trace file (*.ab1) and the sequence 5' to the nucleotide site of interest. The tool measures the peak intensity at the specified site. The ratio of the peak intensity corresponds to the ration of the two viruses (Figure 4B).

6.10.6) Use the GRC web tool (http://indra.mullins.microbiol.washington.edu/grc/) and the recorded peak intensities as the input to calculate viral relative fitness (d). See step 6.10.6.²⁰

• U87 T4 co-receptor cell lines (mycoplasma free):

• CD4 only

• CD4 plus CCR1

• CD4 plus CCR2b

• CD4 plus CCR3

• CD4 plus CCR5

• CD4 plus CXCR4

• cDMEM (DMEM, 10% FBS, 100 U/ml penicillin, 100 µg/ml streptomycin, L-Glutamine, 10mM HEPES)

• Sterile TC 1x PBS.

• 1x Trypsin.

• Geneticin (G418), 300 µg/ml final concentration.

• Puromycin, 1 µg/ml final concentration.

• 96-well microtiterplate with lid (flat bottom), Nuclon, Nunc.

• 24-well plate with lid (flat bottom), Costar?

Passaging:

1. U87 cell stocks are cultured in T25 flasks in 7ml cDMEM with G418 for all cell lines and puromycin for all except parental U87 T4.

2. For passaging, wash monolayer with 5ml warm PBS.

3. Add 0.5ml 1X Trypsin.

4. Incubate 2 minutes at room temperature.

5. Confirm that all cells detach.

6. Add 2ml cDMEM and pipette up and down to completely resuspend all cells.

7. Use 250 µl cell suspension to continue culture. Add 7ml cDMEM and antibiotics.

8. Pellet cells not used for passaging and resuspend at appropriate concentration for further use (i.e. 1 x 10⁵/ml for co-receptor assay).

Co-receptor assay:

1. Per virus per cell line: plate out 1 x 10⁴ cells (100 µl) in cDMEM with antibiotics in 96-well plate.

2. Inoculate with at least 100 TCID₅₀ (in no more than 100 µl).

3. After 24 hours wash with warm PBS.

4. Add 200 µl fresh cDMEM with antibiotics.

5. After 3 and 7 days, take p24 sample. Store at -20°C.

6. After 7 days, score cytopathic effect.

7. Wash monolayer with warm PBS.

8. Add 50 µl 1x Trypsin.

9. Incubate 2 minutes at room temperature.

10. Transfer each well to a new well in a 24-well plate.

11. Add 2 ml cDMEM with antibiotics

12. After 10, 14, 17 and 21 days, take p24 samples. Store at -20°C.

13. After 14 and 21 days, score cytopathic effect.

14. Assay p24 production and discard cultures.

    For specifics on appropriate handling and waste procedures please see the online chemical SOPs or our waste and spill notebook located in room 352.

Equipment

• Single channel pipette: 0.5-10 µl, 10-100 µl, 200-1000 µl, Eppendorf

• Multichannel pipette: 5-50 µl, 50-300 µl, Finnpipette, Labsystems

• Burker Bright-line Count-chamber, Labor Optik

• Adjustable waterbath (37°C)

• Rotixa/RP centrifuge, Hettich

• 37°C/5% CO₂ incubator, Brouwer Scientific

• Biosafety cabinet, Clean Air

• Sterile tray

Disposables

• Disposable pipette: 1, 2, 5, 10, 25, 50 ml, Falcon

• Pipette tips: 1-200 µl, Costar

• Propylene conical tubes: 15 ml, 50 ml, Falcon/Nunclon

• Sterile solution basins, individually wrapped, Labcor

• Microtiter plate: 96-well flat bottom with lid, Nunclon, Nunc

• Tissue culture flask: 25 cm², 75 cm², 175 cm², Nunc

Reagents

• Complete IMDM = IMDM + 10% FBS + Pen/Strep + 5 µg/ml Polybrene

• PHA, use in complete IMDM at 1 µg/ml, Murex (HA16/17)

• rIL-2, use in complete IMDM at 20 U/ml, Boehringer Mannheim

Protocol:

Prepare PHA-stimulated target cells

1. Isolate PBMC by separation over Ficoll gradient

2. Resuspend cells in complete IMDM with PHA, 3 to 5 x 10⁶/ml

3. Incubate 2 to 3 days at 37 °C/5% CO₂

4. Spin 10 minutes at 1500 rpm

5. Resuspend cell pellet in complete IMDM with rIL-2

6. 10 x 10⁶ cells in 10 ml are needed per 96-well plate (100 µl/well)

Prepare patient PBMC

1. Thaw and count cells (resuspended in complete IMDM with rIL-2)

2. Make four 2-fold dilutions of 2.5 ml using up the total amount of cells (e.g. 100,000/ml, 200,000/ml, 400,000/ml and 800,000/ml, resulting in final concentrations of 10,000, 20,000, 40,000, and 80,000 cells/well)

Start co-cultivation in 96-well plates

1. Plate out 100 µl of PHA-stimulated target cells per well

2. Add 100 µl of patient cells per well (24 wells per dilution)

3. Wrap plastic foil around the plates

4. Incubate at 37°C/5% CO₂

Continuation of culture

1. Prepare PHA-stimulated target cells 2-3 days prior as described above

2. Every seven days:

   1.

   1. Resuspend the rest of the culture, transfer 65 µl to a fresh plate containing 135 µl complete IMDM with rIL-2 with 100,000 target cells per well
   2. Add 25,000 MT2 cells per well to the original plate
   3. Score syncytia in this plate after 3 days

Expand biological virus clones

1. When fewer than 33% of wells seeded with a certain concentration are positive, the viruses in one well are thought to originate from one infected cell.

2. Wells that show evidence of HIV-1 replication in that concentration (in p24-ELISA and/or MT-2 culture) can be transferred to a tissue culture flask (25 cm²) containing 5 x 10⁶ PHA-stimulated target cells in 5 ml complete IMDM with rIL-2

3. After 7 to 14 days virus containing cell-free culture supernatants can be collected and stored at -70°C for viral stocks, cells viably frozen and 10⁶ cells stored in lysis buffer for isolation of proviral DNA

   Calculations

   1. The proportion of infected cells is determined according to the formula for Poisson distribution: F=-ln(F₀), in which F₀ is the fraction of negative cultures.

   2. Since CD4⁺ T cells have been shown to be the most important target for HIV-1 in the peripheral blood, virus load is expressed as tissue culture infective doses per 10⁶ CD4⁺ T cells.

      Schematic overview of biological cloning experiments

      

Reagents:

• DPBS: Dulbecco’s Phosphate Buffered Saline, calcium/magnesium free (BioWhittaker #17-515F)

• DTT: Sputolysin (Calbiochem #560000, 20x 10ml). Dilute the contents of 1 vial to 100ml with sterile distilled water. Swirl gently to dissolve any crystals; filter if necessary. Diluted solutions, stored under N₂, are stable for 48 hours at 2-8°C. After opening, vials with undiluted concentrate can be stored under N₂at 2-8°C.

Protocol:

Process sputum within 2 hours of collection.

Keep sputum on ice until ready to process.

Select opaque/dense sputum portions that are different from saliva and free of squamous cell contamination for processing.

Weigh remaining sputum sample.

Add freshly prepared DTT equal to 2x weight of sputum portion.

Incubate 15 minutes at 37°C with frequent shaking.

Vortex every 5 minutes for 15 seconds.

Dilute with equal volume of DPBS.

Filter through 48 µm pore nylon gauze mesh filter.

Take sample for hemocytometer: obtain total cell count and viability.

Spin cells at 2000 rpm for 10 minutes (4°C).

Collect supernatant and store at -80°C.

Resuspend cell pellet in DPBS at 10⁶cells/ml.

Make cytospins with 60,000 to 120,000 cells per slide.

Fix and stain (May-Grunwald Giemsa, Wright, and/or Romanowski stains).

Use remaining cells for culture assays.

References:

1. Pin et al. (1992)Am Rev Respir Dis145:1265-1269.

2. Pin et al. (1992)Thorax47:25-29.

3. Pizzichini et al. (1996)Am J Respir Crit Care Med154:308-317.

4. Pizzichini et al. (1997)Am J Respir Crit Care Med155:1501-1508.

5. Lensmar et al. (1998)Eur Respir J12:595-600.

6. Ward et al. (1999)Clin Exp Allergy29:248-252.

7. Rutgers et al. (2000)Eur Respir J15:109-115.

8. Purovicki et al. (2000)Eur Respir J16:242-246.

9. Alexis et al. (2000)Clin Immunol97:21-32.

10. Zeibecoglou et al. (2000)J Allergy Clin Immunol106:697-704.

• Ficoll-Paque Plus, Pharmacia (cat.no. 17-1440-02).

• Phosphate buffered Saline (PBS), BioWhittaker (cat.no. 17-515F).

• Tri Natrium Citrate Dihydrate (TNC), 38g/l.

• ACK lysing buffer, BioWhittaker (cat.no. 10-548E).

• peripheral blood sample (e.g. 50mls of heparinized blood)

Protocol:

1. Transfer blood to 50 ml tube.

2. Spin at 2000 rpm for 10 minutes.

3. Collect plasma and spin at 3000 rpm for 10 minutes.

4. Collect plasma and store at -80 °C.

5. Dilute remaining cell suspension with PBS/10%TNC to 50 ml.

6. Fill two 50 ml tubes with 12.5 ml Ficoll-Paque Plus each.

7. Gently pipette 25 ml of the diluted cell suspension on top of each 12.5 ml of Ficoll-Paque Plus.

8. Spin 20 minutes at 2000 rpm at room temperature. No brake!

9. Transfer the white blood cell ring fraction to a new 50 ml tube using sterile Pasteur’s pipette.

10. Adjust the volume to 50 ml using PBS/10%TNC.

11. Spin 10 minutes at 1700 rpm.

12. Discard the supernatant.

13. Resuspend each pellet in 2 ml ACK lysing buffer to lyse remaining erythrocytes.

14. Incubate for no more than 2 minutes at room temperature.

15. Adjust the volume to 50 ml using PBS/10%TNC.

16. Spin 10 minutes at 1200 rpm.

17. Resuspend the pellet and count the cells.

Notes: Processing the blood this way will remove thrombocytes from the plasma without activating them, so that plasma can be used for testing of chemokine levels. Before starting Ficoll-Paque Plus and PBS with 10%TNC (v/v) should be at room temparature.

For specifics on appropriate handling and waste procedures please see theonline chemical SOPsor our waste and spill notebook located in room 352.

This document must be read and an agreement/authorization sheet signed and registered with Dr. Mullins.

1. Entry to the BL-3 Facility is restricted to individuals who have obtained prior approval. Authorization to use this facility is contingent on the user’s satisfactory completion of training, understanding of the safety procedures described below, and on his or her ability to follow these guidelines while using the facility. Individuals with little or no prior experience working in a BL-3 facility must have an experienced individual working with them until they become proficient in the safety techniques required.

2. Authorization to use the BL-3 facility requires review and understanding of the following information:

3. 1. Practices outlined in the UW Biohazard Safety Manual, section IV on Biohazard Control Procedures, section VI on Occupational Health Program and section IX on Blood borne Pathogens.

   1. The pamphlet from the CDC-NIH Biosafety in Microbiological and Biomedical Laboratories, pages 25-30, BL-3 Standard Microbiological Practices, Special Practices and Safety Equipment; and pages 116-121, Viral Agents: Retroviruses, Including HIV and SIV. The information in this booklet contains recent information on laboratory-acquired infection with HIV as well as guidelines for the use of biological safety cabinets, cleaning and decontaminating spills, and management of exposures.

   2. The specific rules and procedures outlined in this document for work in the Rosen B44C BL-3 facility.

4. Authorization to use the BL-3 facility requires successful completion of the following:

5. 1. Completion of theMullins B44C BL-3 Facility Usage Authorization Form. Make yourself a copy and turn in completed form to Mullins/Mittler BL3 Lab supervisor (who will make a copy for BL3 Entry Notebook and give copies to appropriate supervisors).

   1. Completion of the EHS course Bloodborne Pathogen Exposure Control, required for laboratory employees working with human blood and blood byproducts. Covers risk assessment, personal protection, safe procedures, emergency response, and disposal of biohazardous waste. Annual refresher training required. Register online athttp://www.ehs.washington.edu/forms/pso/bpecrform.phpor call (206) 543-7201.

   2. Completion of the EHS course, Biological Safety Practices (U Conjoint 420), scheduled upon request, autumn only. If a user already has extensive experience working in a BL-3 facility, this course does not have to be taken prior to beginning their work, but should be taken at the earliest possible convenience.

   3. All users must have experience with tissue culture or working with other human pathogens prior to working with HIV and SIV. A laboratory orientation should be arranged with Dr. Mullins or the BL-3 lab supervisor. At this time, proficiency in biosafety techniques (use of the biosafety cabinets, microscopes, centrifuge safety cups, and proper handling of media and waste material, etc.) must be demonstrated.

   4. Appointment with Occupational Health to cover the following:

   5. 1. Hepatitis B immunization for work with blood or blood products.
      1. Counseling on working with HIV and SIV. This includes receiving a drug prescription for post exposure prophylaxis (PEP).
      2. Drawing of serum sample prior to initiating work in the BL-3 facility. This sample will be stored in the event that HIV seroconversion occurs in order to document the time of seroconversion. They will not be tested without the consent of the individual and then only after a documented exposure occurs. Every 6 months samples can be drawn for HIV testing (optional).

II. Entrance into the Facility

1. Food or drink is not permitted anywhere within the BL-3 laboratory or anteroom.
2. Sandals and shorts are not allowed in the BL-3 facility.
3. Whenever possible, laboratory personnel should avoid handling virus-containing material when he or she has cuts or skin abrasions including, for example, eczema on the hands, wrists or face. If work is necessary, and no replacement for that individual can be found to perform the work, cuts and/or abrasions on the hands and/or wrists should be thoroughly bandaged prior to donning gloves and entrance to the facility. A full-face shield, in addition to the facemask, should be worn to protect cuts and abrasions on the face. Immuno-compromised individuals should not use the facility.
4. The following dress requirements are to be followed by all individuals who use the facility regardless of the reason for entry: within the anteroom and prior to entry to the facility each user should put on one pair of nitrile gloves to cover at least two inches of sleeve (the integrity of the gloves can be checked for tears and punctures by flipping the gloves closed and observing that the air trapped inside is not leaking). The user should then don shoe covers, goggles (or glasses) and a face mask and enter the facility. The gown should be put on immediately upon entrance to the facility, followed by a second pair of latex long gloves. The inner pair of gloves should never be removed or replaced while in the facility unless a tear is suspected. Clean gowns will be provided in the anteroom. Contaminated gowns should be changed immediately. It should be emphasized that the reason for protective clothing is to protect the worker from inadvertent spills of infected media. The purpose of the shoe covers, for example, is to protect shoes from inadvertent spills, however, THE FLOORS (AND ALL SURFACES) SHOULD BE KEPT CLEAN OF SPILLS AND TRASH AT ALL TIMES. PROTECTIVE CLOTHING IS NOT MEANT TO NOR WILL IT EVER REPLACE APPROPRIATE AND PRUDENT WORK PRACTICES. Please note that the housekeeping staff are instructed not to enter this room, you are responsible for keeping it clean.
5. The air pressure in the BL-3 facility should be between -0.05 and -0.10. When the air pressure alarm sounds for a prolonged period of time after entry into the facility and closing the door, all work in the area should cease until the pressure has returned to normal.
6. Do not bring personal items into the lab.
7. Do not apply cosmetics while in the lab.
8. Workmen are only allowed to enter the facility if work is not ongoing and with the approval of Dr. Mullins or the lab supervisor. Workmen should be accompanied by someone authorized to enter the BL-3 facility who will show them the appropriate dress requirements. They should wear gowns and gloves but are not required to wear shoe covers, goggles or facemask, as they will not handle infectious materials.

III. Laboratory Procedures

1. General Considerations:

2. 1. Failure to comply with the practices described below will result in suspension of access privileges.
   1. Double gloves are required to provide protection against exposure to virus through gloves potentially weakened by alcohol, skin oils, other chemicals and overuse. EHS recommends changing your outer gloves every 30 minutes. At any time the outer gloves have been contaminated with culture supernatant, serum or infectious fluid, they should be removed and discarded into the autoclave bag inside the hood. A clean pair of outer gloves should be donned before continuing work. Gloved hands that have been working in the hood, should be sprayed with ethanol or changed prior to touching anything outside of the hood. It is recommended that you wash your hands free of oils and remove rings with sharp edges prior to putting on gloves. To take gloves off, take hold of the glove at the wrist and peel off inside out.

   2. Chemical disinfectants for bloodborne pathogens:
      Care should be taken to minimize splashing when applying chemical disinfectants such as bleach, Wescodyne, or ethanol.

      Appendix Adescribes in detail our procedures for clean up of biohazard spills.

      • Chlorine Bleach(hypochlorite solution ~6-8% hypochlorite): Use 2% (1:50 dilution in water) for surfaces. Use 10% (1:10 dilution) for disposal of liquids containing potentially hazardous pathogens or for soaking heavily soiled tubes, vials etc. Use care - bleach will corrode stainless steel. We use bleach routinely to mop floors (1:50 dilution), for hood aspiration flasks (such that full trap is a final of at least 1:10 bleach), and to contain spills outside hood. Contact time should be at least 10 minutes.
        
      • Wescodyne(Iodophor compound - 0.175% Iodine): Use 1% (1:100 dilution in water) for surfaces. Use 2.5% (1:40 dilution) for disposal of liquids containing potentially hazardous pathogens or for soaking heavily soiled tubes, vials etc. All spills inside hood should be disinfected immediately with 2.5% Wescodyne followed by with 70% ethanol (Wescodyne is corrosive to stainless steel though much less so than bleach; it should not be used on aluminum or copper). We routinely use 2.5% Wescodyne solution in disinfectant buckets, pipet jars, and for spills and splashes inside or outside the hood. Contact time should be at least 10 minutes. Dilute solutions for soaking materials should be changed daily.
        
      • 70% Ethanol: Used to disinfected work surfaces, gloves, plastic surfaces, paper notes, instrument surfaces, and all surfaces where bleach or Wescodyne are inappropriate due to their corrosive and staining characteristics. DO NOT SPRAY ethanol directly into hood or into a spill; use a soaked paper towel.

   3. Aerosols:

      1. Procedures with a high potential for creating aerosols, such as vigorous shaking and vortexing should be performed in the back third of the biological safety cabinet.
      2. Avoid pouring or decanting virus suspensions.
      3. Avoid vigorous pipetting and mixing. Do not forcibly expel the last drop of suspension from a pipette. Discharge pipetted material near the surface of fluid or down the wall of a tube.
      4. When opening culture tubes, bottles and flasks, manipulate them slowly.
      5. When resuspending liquid cultures, use a gentle swirling action to create a homogeneous suspension. Once cultures are resuspended, wait a few minutes before opening the container.
      6. Do not spray or pour disinfectants directly onto liquid spills. Place absorbent paper towels over spill, then pour 10% bleach or 2.5% Wescodyne around and onto towels.

   4. GLASSWARE: Whenever possible, plasticware should be used. Avoid use of glassware.

   5. SHARPS: Hypodermic needles, razor blades, glass Pasteur pipettes and other sharps which can easily penetrate the skin are forbidden in the BL-3 facility unless their use is absolutely necessary and specific permission for their use is obtained from Dr. Mullins.

   6. MOUTH PIPETTING: Mouth pipetting is not permitted. Use of a mechanical pipetting device is required.

   7. VACUUM: Vacuum lines must be protected with high efficiency particulate air (HEPA) filters and liquid disinfectant traps (containing 10% -100% bleach).

   8. Avoid touching your face or any other exposed skin while in the BL-3 facility.

   9. Before using the phone, change outer gloves to clean pair. Swab phone with 70% ethanol after use.

   10. To avoid contamination of an entire notebook, write notes and data in pencil or ethanol resistant pen on single sheets of paper or paper towels. These can then be saturated with ethanol before removing from the BL-3 lab. Protocols brought into the BL-3 lab should be enclosed in a vinyl page protector so that they can be cleaned with ethanol.

3. Work in Biosafety Cabinets

   1. The biosafety cabinet (class II, type A) is not designed for the use of volatile toxic chemicals and volatile radionuclides and therefore they cannot be used in this facility.
   2. The height of the user’s chair should be adjusted to allow comfortable working and prevent a direct line of exposure to the user’s face during normal operation of the hood.
   3. DO NOT TURN THE HOOD BLOWER OFF AT ANY TIME.
   4. MANIPULATIONS OF POTENTIALLY INFECTIOUS MATERIAL shall be conducted in the laminar-flow biosafety cabinets as follows:
      • Each user must clean the hood surfaces with 70% ethanol before initiation of work and after completion of work.
      • Upon completion of work and your exit from BL3, the hood should be clean and free of all material except the followingPERMANENT HOOD RESIDENTS: tip boxes, pipettors, marker, aspiration flask, bleach bottle.BEFORE LEAVING THE BL3 CLEAN OUT YOUR WESCODYNE WASTE AND LEAVE EMPTY BUCKET BY SINK FOR NEXT USER.If you have extenuating circumstances for leaving other items in the hood LEAVE A NOTE WITH YOUR NAME, TIMEDATE, AND WHEN YOU EXPECT TO RETURN TO CLEAN UP!
      • Place bucket (no more than ¾ full) of fresh 2.5% Wescodyne solution in hood.
      • Check aspiration flask. Aspirated liquid waste is collected and disinfected in a 2 L aspiration flask charged with 200 mL undiluted bleach. After aspiration of infectious materials, chase with bleach then 70% ethanol. Empty into sink when ~¾ full; recharge with 200 mL undiluted bleach.
      • Manipulations should be performed as far back from the front air grill as practical. Avoid placing anything on the front or rear grills of the cabinet since these will disrupt the airflow pattern and defeat the purpose of the cabinet.
      • Biological wastes must be exposed to 10% bleach or 2.5% Wescodyne for at least minutes before sink disposal. NOTE: Plastic tips and tubes/vials should be completely submerged and pipettes should be filled to just below the plug. Upon your final exit from the hood, decontaminated plastic pipettes should be transferred to pipette jar. The Wescodyne waste bucket should sprayed with ethanol, the contents strained over the sink, and plastics discarded in small biohazard bag.
      • Radioactive liquid waste will be disinfected with 10% bleach in a separate bleach trap and then transferred to the main lab and treated as general radioactive waste.
   5. TRANSPORT OF POTENTIALLY BIOHAZARDOUS MATERIALS (tubes for centrifugation, culture dishes to be placed in incubators or observed under microscope, etc…) should not leave the hood without being properly sealed. Microscope slides containing infectious materials should be transported and observed within plastic petri dishes and examined while remaining within this container if possible.
   6. AVOID AEROSOLIZATION: Care should be taken to minimize the splatter and/or aerosolization of infectious material inside the hood (e.g. pipette tips should be ejected only when the tip is present wholly within the confines of a plastic vessel containing appropriate disinfectant).

4. Centrifugation

5. 1. Bench Top Centrifuge: Avoid tube collapse by matching the rated speed of the tube with the requirements of your experiment. Make sure to use the appropriate set of matched buckets for the type of tube being used.
      • All centrifugation conducted outside of the biosafety cabinets must be performed using sealed rotors or secondary buckets to contain potential aerosols, leaks, and tube breakage.
      • After centrifugation, the sealed rotor or buckets should be opened only inside a biosafety cabinet. These containers are disinfected in the hood by wiping out carefully with 70% ethanol. They cannot be autoclaved.
   1. Microcentrifuge: When centrifuging infectious substances, the microcentrifuge should be transferred into the hood for use and surface decontaminated prior to removal.

6. Using the Microscope

7. 1. Tighten caps on flasks of infectious culture before transporting to the microscope. Infectious cultures in plates or other containers without snugly fitting lids should be carried to the microscope in a tray.
   1. When using the hemacytometer to count cells, enclose the hemacytometer in a clean/disinfected petri dish with lid for transport to the microscope and observation.
   2. Change or spray gloves with ethanol before touching the microscope.
   3. Disinfect the viewing platform of the microscope after each use.
   4. If you must remove your safety glasses to look through the scope, don’t forget to replace them.

8. Waste Management

9. 1. SHARPS:
      • Pipette tips and plastic pipettes are treated as quasi-sharps because they can puncture autoclave bags. Therefore, after decontamination and straining/draining, they must be double-bagged before autoclaving.
      • Metal sharps that will easily penetrate the skin are not allowed in the BL-3 facility without special permission. Upon completion of the work after at least a 30-minute exposure to bleach, the decontaminated sharps are transferred to a red sharps container to await autoclaving.
   1. SOLID WASTE other than sharps generated inside the hood (vials, tubes, culture flasks, etc.) should be decontaminated, drained then placed directly into the large biohazard bag to await autoclaving. Solid wastes generated outside the hood (paper towels, outer gloves, shoe covers, etc.) are placed directly into the large biohazard bag to await autoclaving.
   2. LIQUID WASTE collected in a bleach trap or a 2.5% Wescodyne solution within the biosafety cabinet must be exposed to disinfectant 10 minutes before sink disposal.

10. Waste Sterilization

11. 1. All solid waste and glassware should be autoclaved for at least 60 minutes at 132°C. Liquid waste must be autoclaved for at least 60 minutes per gallon at 121°C. Laundry should be autoclaved for 30 minutes at 121°C.
    1. All material to be autoclaved should have appropriate autoclave tape attached to confirm that the correct temperature was attained.
    2. A chemical indicator (i.e. steristrip) is placed in the center of EACH LOAD to confirm proper decontamination conditions. Biological testing systems are required at monthly intervals. Records of the temperature, time, results of chemical indicators and biological testing systems must be maintained for each load of waste autoclaved for one year.

12. Identification and Storage of Materials

13. 1. All equipment and materials in the BL-3 facility should be treated as if they are contaminated.
    1. Storage vessels containing biohazardous materials including cultures in incubators and refrigerators and freezers should be labeled to identify their contents, owners, and date.
    2. All equipment such as refrigerators, freezers, incubators, cell counters, centrifuges, etc. used for or containing biohazardous materials must be labeled clearly with the appropriate biohazards symbol.

14. Laboratory Transport

15. 1. Live infectious materials, which are removed from the facility for storage in liquid nitrogen or -70°C freezers should be stored in nonbreakable, cryovials with rubber gasket seals. The vials are surface decontaminated with 70% ethanol after sealing and then transported to the freezers in nonbreakable, impermeable closed containers with biohazard symbols. These containers are assembled and then surface decontaminated prior to exit from the facility.

IV. Exiting the Facility

1. Prior to exiting the facility,each user should check to ensure that he or she has:

2. 1. Appropriately cleaned and disinfected all work areas

   1. Organized tools/supplies into correct storage location

   2. Disposed of generated waste in the proper manner

   3. 1. If the solid waste bag is ¾ full, it must be secured with a single wrap with rubber band and placed in autoclave tray by door. If enough autoclave trays are filled, run autoclave.
      1. If the sharps container is full, it is to be surface decontaminated, transferred to the anteroom, tagged with autoclave tape and autoclaved.
      2. When pipette jar outside hood is ¾ full, the pipettes are to be removed from the tank and allowed to drain in the sink. The pipettes are double-bagged before autoclaving.

   4. Adjusted the water level in the water bath and confirmed that the temperature is set for 37°C

   5. Turned off the aspirator and mechanical pipettor

   6. Turned off the microscope and centrifuges

   7. Wiped down all used switches, handles, and control panels with 70% ethanol

3. Before exiting the work area, users should remove their protective gear in the following order:

4. 1. 1. Shoe covers (spray shoe soles with ethanol)
   1. 2. Outer gloves (spray inner gloves with ethanol)
   2. 3. Mask

EXIT THE WORK AREA

1. In the anteroom remove:
   1. goggles
   2. gown
   3. inner gloves
2. Shoe covers, gloves and masks are disposable and should be placed in the solid waste bins. should be placed in the appropriate bin (yellow bags) in the anteroom to await autoclaving.
3. Hands should be washed in the anteroom prior to leaving the facility.

V. Emergency Procedures

1. Laboratory Accidents

2. 1. Personal Injury or Exposure: All equipment in the BL-3 facility should be treated as if it were contaminated. Any cuts or abrasions obtained while in the facility should be immediately scrubbed for 10 minutes with 1% Wescodyne, soap and water. For mucous membrane exposure, thoroughly flush the surface for several minutes. There is an eye wash fountain located in the BL-3 facility. The user should then exit the facility using appropriate exiting procedures and seek immediate medical attention with the Occupational Health nurse practitioner, room NN256A; phone number (206) 548-4848. If the accident occurs after hours, go directly to the UW Medical Center emergency room. The occupational nurse/emergency room will evaluate the wound, draw a blood sample and give any necessary treatment; including HAART. The incident should be reported to Dr. Mullins or the lab supervisor and an Accident Report Form filed with EHS within 24 hours of the exposure.
   1. Centrifuge Malfunctions: Centrifuge malfunctions should be handled in such a way as to avoid personal injury or exposure. If an imbalance occurs or a bucket is thrown from the rotor, the unit should immediately be turned off. Even in non-emergency situations, centrifugation is a procedure that is potentially hazardous when working with biohazardous material. Aerosols can be detected during the filling of centrifuge tubes, removal of caps or removal of contents. Breakage of tubes during centrifugation produces the greatest amount of aerosol. Safety sealed centrifuge cups will not allow the escape of contents or an aerosol in the event of an accident, provided that they are sealed properly and only opened in a biological safety cabinet.
   2. Fire Alarm: If working with live materials, the cultures should be returned to the incubator and the facility should be exited using the appropriate exiting procedures.
   3. Earthquake: Flying glass from the hood and sliding or falling heavy equipment are the primary dangers during an earthquake. Move immediately away from the front of the hood, freezer and stacked incubator. Stand flush against the wall. Watch for falling equipment and supplies. Some users may be able to duck under the knee space on the hood, which will lend some protection from overhead. After the earthquake, survey the area for biological or chemical spills; clean the spills only if the area is safe. If the area is not safe and the spill occurred in the hood, remove the lid of the dilute Wescodyne solution and overturn it in the hood. Leave as quickly as possible following the appropriate exit procedures. If there is time, leave a note on the door stating that a biological spill has occurred.

APPENDIX A - CLEAN-UP OF BIOHAZARDOUS SPILLS

1. Biohazardous Spills in the Biological Safety Cabinet
   Chemical decontamination procedures should be initiated at once while the cabinet continues to operate to prevent escape of contaminants from the cabinet.

2. 1. It is best to soak the spill into paper towels and pour 2.5% Wescodyne such that it seeps into the paper towels rather than pouring directly onto the spill and generating aerosols. Allow the detergent to act for 10 minutes then transfer soaked paper towels to an autoclave bag within the hood. Wipe walls, work surfaces, and equipment with detergent. The operator should be in protective gear during this procedure.
   1. If the spill has spread to the catch basin underneath the front grill, wipe the grill with 2.5% Wescodyne, remove the grill and place it in the hood, soak up liquid in the catch basin with paper towels, and disinfect with Wescodyne as in “A” above. After paper towels have been removed, replace grill.
   2. Seal and decontaminate the outside of the autoclave bag used to collect the soaked paper towels, remove from the hood and autoclave.

3. Biohazard Spill Outside of a Biological Safety Cabinet

4. 1. Holding your breath leave the room immediately and close the door.
   1. Warn others not to enter the contaminated area. Post a sign on the door if you leave the immediate vicinity.
   2. In the anteroom, remove and properly dispose of contaminated garments and protective gear. Thoroughly wash hands and face.
   3. Wait 30 minutes to allow dissipation of aerosols created by the spill.
   4. Put on clean protective gear before reentering the room. If the spill was of high titer virus, the use of a respirator and tight fitting goggles should be considered.
   5. Use paper towels to soak up the liquid. Then pour detergent around the spill such that it flows into the towels. To minimize aerosolization, avoid pouring directly into the spill.
   6. Let stand 20 minutes to allow adequate disinfectant contact time.
   7. Using a dustpan and sponge or small broom transfer all contaminated materials into an autoclave bag with as little hand contact as possible. If there is broken glass involved, transfer to a deep autoclave pan instead. DO NOT ATTEMPT TO PICK UP ANY BROKEN GLASS BY HAND!
   8. Prepare a container of dilute detergent and sponge off the floor, removing as much liquid as possible.
   9. Autoclave waste along with the dustpan and sponge. If the broom cannot be autoclaved, let it soak in 5% Wescodyne for 30 minutes or more and then rinse.
   10. Report the spill to Dr. Mullins or the BL-3 lab supervisor.

5. Radioactive Biohazard Spill Outside a Biological Safety Cabinet

6. 1. Follow A-D from above. Before clean-up procedures begin, contact a radiation safety officer (543-6328). The spill should be surveyed for external radiation hazard prior to determining the course of action.

Mullins' B44C BL-3 Facility

I, (print name) _______________________________________, have read, understand and will comply with the safety practices outlined in the University of Washington Biosafety Manual, the CDC•NIH guidelines for Biosafety Level 3 practices and the Mullins' lab rules and regulations regarding the Rosen B44C BL-3 facility.

Lab of Trainee (PI):__________________________________

Trainee Lab Trainer:__________________________________(assigned by PI)

Trainee Name:__________________________________

Signature:__________________________________

Mullins Lab Trainer:_________________________________________

Date Trained:____________________

Additional Comments:

The person named above has successfully completed training supervised by Dr. Mullins or the BL-3 lab supervisor and is now authorized to use the Rosen B44C BL-3 facility.

__________________________________ (James I. Mullins)

__________________________________ (Date)

For specifics on appropriate handling and waste procedures please see theonline chemical SOPsor our waste and spill notebook located in room 352.